RPB0338

Pathogen Description

Target Pathogen Pathogen Name NCBI Taxonomy ID Order Family Genus Species Pathogen type
SARS-CoV-2 SARS-CoV-2, 2019-nCoV, COVID-19, COVID-19 virus, SARS2, Wuhan coronavirus, Human coronavirus 2019, COVID19, HCoV-19, SARS-2, SARS-CoV4 2697049 Nidovirales Coronaviridae Betacoronavirus Severe acute respiratory syndrome-related coronavirus virus

Primer Description

Primer Name Sequence(5'-3') Length(bp) Primer Final Concentration(μM） GC Content（%） Predicted Melting Temperature(℃） Molecular Weight(g/moles) Positions in GenBank accession number
N-F AGGCAGCAGTAGGGGAACTTCTCCTGCTAGAAT 33 10 μM 51.52 66.82 10202.68 \
N-R TTGGCCTTTACCAGACATTTTGCTCTCAAGCTG 33 10 μM 45.45 63.78 10045.57 \

Gene Description

Target Gene GenBank ID
N gene \

Assay Description

Application Assay Primer Designing Software Reaction Time(min) Assay Temperature(℃) Readout System(s) Limit of Detection(LoD) Sensitivity(%) Specificity(%)
an inexpensive, accurate, rapid, and portable at-home nucleic acid detection strategy RPA+CRISPR\Cas12a \ 13 min 39℃ CRISPR\Cas12a 2 copies/μL \ \

Publication Description

Year of Publication Title Author(s) Journal PMID DOI
2024 A miniaturized RPA-CRISPR\Cas12a-based nucleic acid diagnostic platform for rapid and simple self-testing of SARS-CoV-2 Tianyi Zhang,Xiaoqin Wang,Yingtao Jiang,Yunyun Zhang,Shuhao Zhao,Jian Hu,Fei Hu,Niancai Peng Analytica Chimica Acta 39832863 10.1016/j.aca.2024.343593

A miniaturized RPA-CRISPR\Cas12a-based nucleic acid diagnostic platform for rapid and simple self-testing of SARS-CoV-2

Author(s):

Tianyi Zhang,Xiaoqin Wang,Yingtao Jiang,Yunyun Zhang,Shuhao Zhao,Jian Hu,Fei Hu,Niancai Peng

Journal:

Analytica Chimica Acta

Year:

2024

Abstract:

Nucleic acid testing is the most effective detection method currently available for the diagnosis of respiratory infectious diseases. However, the conventional real-time fluorescent quantitative PCR technique, which is regarded as the gold standard method for nucleic acid detection, presents significant challenges for implementation in home self-testing and popularization in underdeveloped regions due to its rigorous experimental standards. It is therefore clear that an easy-to-use, miniaturized nucleic acid testing technology and products for nonprofessionals are of great necessity to define the pathogens and assist in controlling disease transmission. (87) RESULTS: In this study, we propose a strategy for self-testing of respiratory pathogen nucleic acid that is oriented towards the public and user-friendly. The proposed system integrates the processes of extraction-free nucleic acid release, RPA isothermal amplification, and CRISPR fluorescence detection into a compact configuration. A microfluidic testing chip actuated by air pouches and a battery/USB-powered reusable device has been developed to enable simultaneous detection of internal reference genes and viral targets in a fully enclosed condition. The system allows for sample-in, and result-out testing in less than 30 min with a detection limit of 2 copies/μL. Additionally, a straightforward signal-light-based result display method has been developed to make it easy and intuitive for users to access the results. Furthermore, freeze-drying reagent is introduced to guarantee the storage and transportation of testing chips in ambient conditions. (135) SIGNIFICANCE: This work presents a miniaturized, portable, and highly sensitive nucleic acid detection system, where simple operating procedures have been designed for unskilled users. It is our belief that the testing system developed in this work is well suited for home-based self-testing and infection diagnosis in resource-limited areas, due to the above-mentioned advantages. (52).