RPB0320

Pathogen Description

Target Pathogen Pathogen Name NCBI Taxonomy ID Order Family Genus Species Pathogen type
Staphylococcus aureus Staphylococcus aureus, Micrococcus aureus, Staphylococcus pyogenes aureus 1280 Bacillales Staphylococcaceae Staphylococcus Staphylococcus aureus Bacterium

Primer Description

Primer Name Sequence(5'-3') Length(bp) Primer Final Concentration(μM) GC Content(%) Predicted Melting Temperature(℃) Molecular Weight(g/moles) Positions in GenBank accession number
RPA-F- S. aureus GCATCACAAACAGATAACGGCGTAAATAGAAG 32 \ 40.63 59.09 9892.54 \
RPA-R- S. aureus ACATTAATTTAACCGTATCACCATCAATCGCT 32 \ 34.38 57.47 9686.39 \

Gene Description

Target Gene GenBank ID
nuc gene \

Assay Description

Application Assay Primer Designing Software Reaction Time(min) Assay Temperature(℃) Readout System(s) Limit of Detection(LoD) Sensitivity(%) Specificity(%)
\ RPA-CRISPR\Cas12a \ 30 min 37°C CRISPR\Cas12a 3 CFU\mL 102 CFU\mL \

Publication Description

Year of Publication Title Author(s) Journal PMID DOI
2024 Advanced Electrochemical Biosensing toward Staphylococcus aureus Based on the RPA-CRISPR\Cas12a System and Conductive Nanocomposite Yiqing Guo,Chen Li,Wang Guo,Xinai Zhang,Li Wang,Wen Zhang,Xiaobo Zou,Zongbao Sun Agricultural and Food Chemistry 39356521 10.1021/acs.jafc.4c07308

Advanced Electrochemical Biosensing toward Staphylococcus aureus Based on the RPA-CRISPR\Cas12a System and Conductive Nanocomposite

Author(s):

Yiqing Guo,Chen Li,Wang Guo,Xinai Zhang,Li Wang,Wen Zhang,Xiaobo Zou,Zongbao Sun

Journal:

Agricultural and Food Chemistry

Year:

2024

Abstract:

Staphylococcus aureus (S. aureus) is a prevalent foodborne pathogen that poses significant challenges to food safety. Herein, a sensitive and specific electrochemical biosensor based on RPA-CRISPR/Cas12a is developed for evaluating S. aureus. In the presence of S. aureus, the extracted target DNA fragments are efficiently amplified by recombinase polymerase amplification (RPA). The designed crRNA, binding to Cas12a, effectively recognizes the target fragment cleaving hpDNA. The signal molecule of hpDNA is cleaved from the sensing interface, resulting in a reduction of current response. Under optimal experimental conditions, the developed electrochemical biosensor exhibits remarkable sensitivity in detecting S. aureus. The linear range for quantifying S. aureus in pure culture is 1.04 × 101-1.04 × 108 CFU/mL, with a detection limit as low as 3 CFU/mL. In addition, the biosensor enables the accurate and sensitive detection of S. aureus in milk within a linear range of 1.07 × 101-1.07 × 107 CFU/mL. The electrochemical biosensor enhances anti-interference capability owing to the specific amplification of RPA primers and the single-base recognition ability of crRNA. The RPA-CRISPR/Cas12a biosensor exhibits exceptional anti-interference capability, precision, and sensitivity, thereby establishing a robust foundation for real-time monitoring of microbial contamination.