RPB0317

Pathogen Description

Target Pathogen Pathogen Name NCBI Taxonomy ID Order Family Genus Species Pathogen type
Klebsiella pneumoniae Klebsiella pneumoniae, Bacillus pneumoniae, Hyalococcus pneumoniae 573 Enterobacterales Enterobacteriaceae Klebsiella Klebsiella pneumoniae Bacterium

Primer Description

Primer Name Sequence(5'-3') Length(bp) Primer Final Concentration(μM) GC Content(%) Predicted Melting Temperature(℃) Molecular Weight(g/moles) Positions in GenBank accession number
khe-RAA-OF GGTTTACGTCTCAACCGGCTGGGGATCCAC 30 10 μmol\L 60 68.54 9199 \
khe-RAA-OR CTTCCTGCTCGGTGTTATTGAGAAAGGTGT 30 10 μmol\L 46.67 62 9259.05 \

Gene Description

Target Gene GenBank ID
khe gene \

Assay Description

Application Assay Primer Designing Software Reaction Time(min) Assay Temperature(℃) Readout System(s) Limit of Detection(LoD) Sensitivity(%) Specificity(%)
a highly sensitive and rapid single-tube, two-stage, multiplex recombinase-aided qPCR (mRAP) assay to specifically detect the khe, blaKPC-2, and blaNDM-1genes in Klebsiella pneumoniae. mRAP oligo7 15 min 42°C \ 10 copies 10 −5 ng/μL 1

Publication Description

Year of Publication Title Author(s) Journal PMID DOI
2024 A Multiplex Recombinase-Aided qPCR Assay for Highly Sensitive and Rapid Detection of khe, blaKPC-2, and blaNDM-1 Genes in Klebsiella pneumoniae Shao-Wei Hua,Jie Wang,Zi-Jin Zhao,Feng-Yu Tian,Meng Zhao,Yu-Xin Wang,Rui-Qing Zhang,Zhi-Qiang Han,Shi-Jue Gao,Xiao-Na Lv,Hong-Yi Li,Xin-Xin Shen,Xue-Jun Ma,Zhi-Shan Feng Clinical Laboratory Analysis 38590133 10.1002/jcla.25038

A Multiplex Recombinase-Aided qPCR Assay for Highly Sensitive and Rapid Detection of khe, blaKPC-2, and blaNDM-1 Genes in Klebsiella pneumoniae

Author(s):

Shao-Wei Hua,Jie Wang,Zi-Jin Zhao,Feng-Yu Tian,Meng Zhao,Yu-Xin Wang,Rui-Qing Zhang,Zhi-Qiang Han,Shi-Jue Gao,Xiao-Na Lv,Hong-Yi Li,Xin-Xin Shen,Xue-Jun Ma,Zhi-Shan Feng

Journal:

Clinical Laboratory Analysis

Year:

2024

Abstract:

Objective: This study aimed to establish a highly sensitive and rapid single-tube, two-stage, multiplex recombinase-aided qPCR (mRAP) assay to specifically detect the khe, blaKPC-2, and blaNDM-1 genes in Klebsiella pneumoniae. Methods: mRAP was carried out in a qPCR instrument within 1 h. The analytical sensitivities of mRAP for khe, blaKPC-2, and blaNDM-1 genes were tested using recombinant plasmids and dilutions of reference strains. A total of 137 clinical isolates and 86 sputum samples were used to validate the clinical performance of mRAP. Results: mRAP achieved the sensitivities of 10, 8, and 14 copies/reaction for khe, blaKPC-2, and blaNDM-1 genes, respectively, superior to qPCR. The Kappa value of qPCR and mRAP for detecting khe, blaKPC-2, and blaNDM-1 genes was 1, 0.855, and 1, respectively (p < 0.05). Conclusion: mRAP is a rapid and highly sensitive assay for potential clinical identification of khe, blaKPC-2, and blaNDM-1 genes in K. pneumoniae.