RPB0307

Pathogen Description

Target Pathogen Pathogen Name NCBI Taxonomy ID Order Family Genus Species Pathogen type
SARS-CoV-2 SARS-CoV-2, 2019-nCoV, COVID-19, COVID-19 virus, SARS2, Wuhan coronavirus, Human coronavirus 2019, COVID19, HCoV-19, SARS-2, SARS-CoV4 2697049 Nidovirales Coronaviridae Betacoronavirus Severe acute respiratory syndrome-related coronavirus virus

Primer Description

Primer Name Sequence(5'-3') Length(bp) Primer Final Concentration(μM） GC Content（%） Predicted Melting Temperature(℃） Molecular Weight(g/moles) Positions in GenBank accession number
F [Biotin] TTTTTTTTTTTTGTTAATCTTATAACCAGAACTCAAT 37 10 μM 18.92 51.76 11258.41 \
R [Cy5] AGAACAAGTCCTGAGTTGAATGTA 24 10 μM 37.5 53.01 7424.92 \

Gene Description

Target Gene GenBank ID
Omicron variant BA.2 NCCP 43412

Assay Description

Application Assay Primer Designing Software Reaction Time(min) Assay Temperature(℃) Readout System(s) Limit of Detection(LoD) Sensitivity(%) Specificity(%)
rapidity, high sensitivity, specificity, multiplexing capability, and ability to simplify equipment of this technology highlight its potential for broad applications in clinical diagnostics and public health surveillance. RPA-Nanoplasmonic microarrays \ 30 min 39°C Nanoplasmonic microarrays four copies 4 copies\rxn (16.7 zM) \

Publication Description

Year of Publication Title Author(s) Journal PMID DOI
2024 Nanoplasmonic microarray–based solid-phase amplification for highly sensitive and multiplexed molecular diagnostics: application for detecting SARS-CoV-2 Ji Young Lee,Hyowon Jang,Sunjoo Kim,Taejoon Kang,Sung-Gyu Park,Min-Young Lee Mikrochim Acta 39472332 10.1007/s00604-024-06723-4

Nanoplasmonic microarray–based solid-phase amplification for highly sensitive and multiplexed molecular diagnostics: application for detecting SARS-CoV-2

Author(s):

Ji Young Lee,Hyowon Jang,Sunjoo Kim,Taejoon Kang,Sung-Gyu Park,Min-Young Lee

Journal:

Mikrochim Acta

Year:

2024

Abstract:

A novel approach is introduced using nanoplasmonic microarray-based solid-phase recombinase polymerase amplification (RPA) that offers high sensitivity and multiplexing capabilities for gene detection. Nanoplasmonic microarrays were developed through one-step immobilization of streptavidin/biotin primers and fine-tuning the amplicon size to achieve high plasmon-enhanced fluorescence (PEF) on the nanoplasmonic substrate, thereby improving sensitivity. The specificity and sensitivity of solid-phase RPA on nanoplasmonic microarrays was evaluated in detecting E, N, and RdRP genes of SARS-CoV-2. High specificity was achieved by minimizing primer-dimer formation and employing a stringent washing process and high sensitivity obtained with a limit of detection of four copies per reaction within 30 min. In clinical testing with nasopharyngeal swab samples (n = 30), the nanoplasmonic microarrays demonstrated a 100% consistency with the PCR results for detecting SARS-CoV-2, including differentiation of Omicron mutations BA.1 and BA.2. This approach overcomes the sensitivity issue of solid-phase amplification, as well as offers rapidity, high multiplexing capabilities, and simplified equipment by using isothermal reaction, making it a valuable tool for on-site molecular diagnostics.