RPB0302

Pathogen Description

Target Pathogen Pathogen Name NCBI Taxonomy ID Order Family Genus Species Pathogen type
Klebsiella pneumoniae Klebsiella pneumoniae, Bacillus pneumoniae, Hyalococcus pneumoniae 573 Enterobacterales Enterobacteriaceae Klebsiella Klebsiella pneumoniae Bacterium

Primer Description

Primer Name Sequence(5'-3') Length(bp) Primer Final Concentration(μM) GC Content(%) Predicted Melting Temperature(℃) Molecular Weight(g/moles) Positions in GenBank accession number
RPA-F GCCGTGCAATACAGTGATAACGCCGCCGCCA 31 10 nM 61.29 71.96 9475.2 \
RPA-R CAGCCAGTGCAGAGCCCAGTGTCAGTTTTTGTA 33 10 nM 51.52 67 10144.63 \

Gene Description

Target Gene GenBank ID
blaKPC gene \

Assay Description

Application Assay Primer Designing Software Reaction Time(min) Assay Temperature(℃) Readout System(s) Limit of Detection(LoD) Sensitivity(%) Specificity(%)
a promising tool for the cost-effective, convenient, and accurate detection of the blaKPC gene RPA-CRPSPR-Cas12a-lateral flow test strip Primer3Plus 60min 37 °C CRISPR\Cas12a-lateral flow test strip 1 aM (~1 copy µL−1) 1 1

Publication Description

Year of Publication Title Author(s) Journal PMID DOI
2024 Cas12a\Guide RNA-Based Platform for Rapidly and Accurately Detecting blaKPC Gene in Carbapenem-Resistant Enterobacterales Keke Li,Yaozhou Wu,Meng Liu,Junwen Yan,Lianhua Wei Infection and Drug Resistance 38915320 10.2147/IDR.S462088

Cas12a\Guide RNA-Based Platform for Rapidly and Accurately Detecting blaKPC Gene in Carbapenem-Resistant Enterobacterales

Author(s):

Keke Li,Yaozhou Wu,Meng Liu,Junwen Yan,Lianhua Wei

Journal:

Infection and Drug Resistance

Year:

2024

Abstract:

Purpose: Accurate detection and identification of pathogens and their associated resistance mechanisms are essential prerequisites for implementing precision medicine in the management of Carbapenem-resistant Enterobacterales (CRE). Among the various resistance mechanisms, the production of KPC carbapenemase is the most prevalent worldwide. Consequently, this study aims to develop a convenient and precise nucleic acid detection platform specifically for the blaKPC gene. Methods: The initial phase of our research methodology involved developing a CRISPR/Cas12a detection framework, which was achieved by designing highly specific single-guide RNAs (sgRNAs) targeting the blaKPC gene. To enhance the sensitivity of this system, we incorporated three distinct amplification techniques-polymerase chain reaction (PCR), loop-mediated isothermal amplification (LAMP), and recombinase polymerase amplification (RPA)-into the CRISPR/Cas12a framework. Subsequently, we conducted a comparative analysis of the sensitivity and specificity of these three amplification methods when used in combination with the CRISPR/Cas12a system. Additionally, we assessed the clinical applicability of the methodologies by evaluating fluorescence readouts from 80 different clinical isolates. Furthermore, we employed lateral flow assay technology to provide a visual representation of the results, facilitating point-of-care testing. Results: Following a comparative analysis of the sensitivity and specificity of the three methods, we identified the RPA-Cas12a approach as the optimal detection technique. Our findings demonstrated that the limit of detection (LoD) of the RPA-Cas12a platform was 1 aM (~1 copy/µL) for plasmid DNA and 5 × 10³ fg/µL for genomic DNA. Furthermore, both the sensitivity and specificity of the platform achieved 100% upon validation with 80 clinical isolates. Conclusion: These findings suggest that the developed RPA-Cas12a platform represents a promising tool for the cost-effective, convenient, and accurate detection of the blaKPC gene.