RPB0270

Pathogen Description

Target Pathogen Pathogen Name NCBI Taxonomy ID Order Family Genus Species Pathogen type
Klebsiella pneumoniae Klebsiella pneumoniae, Bacillus pneumoniae, Hyalococcus pneumoniae 573 Enterobacterales Enterobacteriaceae Klebsiella Klebsiella pneumoniae Bacterium

Primer Description

Primer Name Sequence(5'-3') Length(bp) Primer Final Concentration(μM) GC Content(%) Predicted Melting Temperature(℃) Molecular Weight(g/moles) Positions in GenBank accession number
KP-mdhF GCAATTTACCCATAAGAAAAACCGTTCCCTG 31 25 μM 41.94 59.77 9432.22 \
KP-mdhF CGCTTGCTCTTCGATAGTTTCAACCACTCC 30 25 μM 50 62.98 9043.92 \

Gene Description

Target Gene GenBank ID
\ \

Assay Description

Application Assay Primer Designing Software Reaction Time(min) Assay Temperature(℃) Readout System(s) Limit of Detection(LoD) Sensitivity(%) Specificity(%)
rapid and reliable results that are crucial for clinical diagnosis RAA-CRISPR \ 40 min 39°C CRISPR detectionAMIC system b 10¹CFU\mL 1 1

Publication Description

Year of Publication Title Author(s) Journal PMID DOI
2024 Automatic Microfluidic Harmonized RAA-CRISPR Diagnostic System for Rapid and Accurate Identification of Bacterial Respiratory Tract Infections Xinran Xiang,Xiaoqing Ren,Qianyu Wen,Gaowa Xing,Yuting Liu,Xiaowei Xu,Yuhuan Wei,Yuhan Ji,Tingting Liu,Huwei Song,Shenghang Zhang,Yuting Shang,Minghui Song Analytical Chemistry 38595038 10.1021/acs.analchem.3c05682

Automatic Microfluidic Harmonized RAA-CRISPR Diagnostic System for Rapid and Accurate Identification of Bacterial Respiratory Tract Infections

Author(s):

Xinran Xiang,Xiaoqing Ren,Qianyu Wen,Gaowa Xing,Yuting Liu,Xiaowei Xu,Yuhuan Wei,Yuhan Ji,Tingting Liu,Huwei Song,Shenghang Zhang,Yuting Shang,Minghui Song

Journal:

Analytical Chemistry

Year:

2024

Abstract:

Respiratory tract infections (RTIs) pose a grave threat to human health, with bacterial pathogens being the primary culprits behind severe illness and mortality. In response to the pressing issue, we developed a centrifugal microfluidic chip integrated with a recombinase-aided amplification (RAA)-clustered regularly interspaced short palindromic repeats (CRISPR) system to achieve rapid detection of respiratory pathogens. The limitations of conventional two-step CRISPR-mediated systems were effectively addressed by employing the all-in-one RAA-CRISPR detection method, thereby enhancing the accuracy and sensitivity of bacterial detection. Moreover, the integration of a centrifugal microfluidic chip led to reduced sample consumption and significantly improved the detection throughput, enabling the simultaneous detection of multiple respiratory pathogens. Furthermore, the incorporation of Chelex-100 in the sample pretreatment enabled a sample-to-answer capability. This pivotal addition facilitated the deployment of the system in real clinical sample testing, enabling the accurate detection of 12 common respiratory bacteria within a set of 60 clinical samples. The system offers rapid and reliable results that are crucial for clinical diagnosis, enabling healthcare professionals to administer timely and accurate treatment interventions to patients.