RPB0263

Pathogen Description

Target Pathogen Pathogen Name NCBI Taxonomy ID Order Family Genus Species Pathogen type
Mycobacterium Mycobacterium 1763 Corynebacteriales Mycobacteriaceae Mycobacterium 0 Bacterium

Primer Description

Primer Name Sequence(5'-3') Length(bp) Primer Final Concentration(μM） GC Content（%） Predicted Melting Temperature(℃） Molecular Weight(g/moles) Positions in GenBank accession number
Myco-F AATAACTCCGTACCCGGAGCSCC 23 10 μM 60.87 60.87 6958.59 \
Myco-R CGACGAGTGCAAAGACAAGGACATGACGTACGCGGC 36 10 μM 58.33 71.07 11162.31 \

Gene Description

Target Gene GenBank ID
rpoB gene \

Assay Description

Application Assay Primer Designing Software Reaction Time(min) Assay Temperature(℃) Readout System(s) Limit of Detection(LoD) Sensitivity(%) Specificity(%)
an effective, portable, rapid, and accurate screening method for mycobacterial detection and identification, MyTRACK( RPA and CRISPR-Cas12a ) Jalview version 2.11.3.2. 30 min 39°C CRISPR-Cas12a 1 to 100 copies 92.59 % to 100 % 1

Publication Description

Year of Publication Title Author(s) Journal PMID DOI
2025 CRISPR-Cas12a-based detection and differentiation of Mycobacterium spp Peeraphan Compiro,Nantinee Chomta,Juthamas Nimnual,Samitanan Sunantawanit,Sunchai Payungporn,Suwatchareeporn Rotcheewaphan,Pornchai Keawsapsak Clinica Chimica Acta 39725131 10.1016/j.cca.2024.120101

CRISPR-Cas12a-based detection and differentiation of Mycobacterium spp

Author(s):

Peeraphan Compiro,Nantinee Chomta,Juthamas Nimnual,Samitanan Sunantawanit,Sunchai Payungporn,Suwatchareeporn Rotcheewaphan,Pornchai Keawsapsak

Journal:

Clinica Chimica Acta

Year:

2025

Abstract:

Mycobacterium species cause several vital human diseases, including tuberculosis and non-tuberculous mycobacterial infections, which are treated with different drug regimens Therefore, accurate and rapid diagnosis is essential for effective treatment and controlling the spread of these pathogens. This study aims to develop an isothermal method combining RPA and CRISPR-Cas12a techniques, named as MyTRACK, to detect and differentiate major clinical mycobacteria at the species level. The assay has no cross-reactivity with limit of detection of 1 to 100 copies/reaction for various targeted mycobacteria. The results demonstrated 100 % specificity and 92.59 % to 100 % sensitivity in clinical isolates and were consistent with the culture technique with LPA for clinical samples. The MyTRACK assay is an effective, portable, rapid, and accurate screening method for mycobacterial detection and identification, especially in low-resource clinical settings.