RPB0253

Pathogen Description

Target Pathogen Pathogen Name NCBI Taxonomy ID Order Family Genus Species Pathogen type
SARS-CoV-2 SARS-CoV-2, 2019-nCoV, COVID-19, COVID-19 virus, SARS2, Wuhan coronavirus, Human coronavirus 2019, COVID19, HCoV-19, SARS-2, SARS-CoV4 2697049 Nidovirales Coronaviridae Betacoronavirus Severe acute respiratory syndrome-related coronavirus virus

Primer Description

Primer Name Sequence(5'-3') Length(bp) Primer Final Concentration(μM) GC Content(%) Predicted Melting Temperature(℃) Molecular Weight(g/moles) Positions in GenBank accession number
OF1 CCGGTAACAAACCTTGTAATGGTGTTGCAGGT 32 10 µM 46.88 64.04 9879.47 \
OF1 CATGTAGAAGTTCAAAAGAAAGTACTACTACTCTG 35 10 µM 34.29 55.72 10771.1 \

Gene Description

Target Gene GenBank ID
F486V;49X \

Assay Description

Application Assay Primer Designing Software Reaction Time(min) Assay Temperature(℃) Readout System(s) Limit of Detection(LoD) Sensitivity(%) Specificity(%)
a simple, rapid method without contamination risk. RPA\CRISPR-Cas12a \ 1 h 39℃ CRISPR-Cas12a 30 copies 0.973 1

Publication Description

Year of Publication Title Author(s) Journal PMID DOI
2024 A photocontrolled one-pot isothermal amplification and CRISPR-Cas12a assay for rapid detection of SARS-CoV-2 Omicron variants Qian Sun,Hongqing Lin,Yuan Li,Liping Yuan,Baisheng Li,Yunan Ma,Haiying Wang,Xiaoling Deng,Hongliang Chen,Shixing Tang Microbiology Spectrum 38319081 10.1128/spectrum.03645-23

A photocontrolled one-pot isothermal amplification and CRISPR-Cas12a assay for rapid detection of SARS-CoV-2 Omicron variants

Author(s):

Qian Sun,Hongqing Lin,Yuan Li,Liping Yuan,Baisheng Li,Yunan Ma,Haiying Wang,Xiaoling Deng,Hongliang Chen,Shixing Tang

Journal:

Microbiology Spectrum

Year:

2024

Abstract:

CRISPR-Cas technology has widely been applied to detect single-nucleotide mutation and is considered as the next generation of molecular diagnostics. We previously reported the combination of nucleic acid amplification (NAA) and CRISPR-Cas12a system to distinguish major severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) variants. However, the mixture of NAA and CRISPR-Cas12a reagents in one tube could interfere with the efficiency of NAA and CRISPR-Cas12a cleavage, which in turn affects the detection sensitivity. In the current study, we employed a novel photoactivated CRISPR-Cas12a strategy integrated with recombinase polymerase amplification (RPA) to develop one-pot RPA/CRISPR-Cas12a genotyping assay for detecting SARS-CoV-2 Omicron sub-lineages. The new system overcomes the potential inhibition of RPA due to early CRISPR-Cas12a activation and cleavage of the target template in traditional one-pot assay using photocleavable p-RNA, a complementary single-stranded RNA to specifically bind crRNA and precisely block Cas12a activation. The detection can be finished in one tube at 39℃ within 1 h and exhibits a low limit of detection of 30 copies per reaction. Our results demonstrated that the photocontrolled one-pot RPA/CRISPR-Cas12a assay could effectively identify three signature mutations in the spike gene of SARS-CoV-2 Omicron variant, namely, R346T, F486V, and 49X, and distinguish Omicron BA.1, BA.5.2, and BF.7 sub-lineages. Furthermore, the assay achieved a sensitivity of 97.3% and a specificity of 100.0% and showed a concordance of 98.3% with Sanger sequencing results.IMPORTANCEWe successfully developed one-pot recombinase polymerase amplification/CRISPR-Cas12a genotyping assay by adapting photocontrolled CRISPR-Cas technology to optimize the conditions of nucleic acid amplification and CRISPR-Cas12a-mediated detection. This innovative approach was able to quickly distinguish severe acute respiratory syndrome coronavirus 2 Omicron variants and can be readily modified for detecting any nucleic acid mutations. The assay system demonstrates excellent clinical performance, including rapid detection, user-friendly operations, and minimized risk of contamination, which highlights its promising potential as a point-of-care testing for wide applications in resource-limiting settings.