RPB0250

Pathogen Description

Target Pathogen Pathogen Name NCBI Taxonomy ID Order Family Genus Species Pathogen type
Klebsiella pneumoniae Klebsiella pneumoniae, Bacillus pneumoniae, Hyalococcus pneumoniae 573 Enterobacterales Enterobacteriaceae Klebsiella Klebsiella pneumoniae Bacterium

Primer Description

Primer Name Sequence(5'-3') Length(bp) Primer Final Concentration(μM） GC Content（%） Predicted Melting Temperature(℃） Molecular Weight(g/moles) Positions in GenBank accession number
rcsA-F ACCCGGCGACGCTGTTTGTTATCTTTATGT 30 10 μM 46.67 63.65 9169.99 \
rcsA-R GATACCGTCTTCGCTTTGATGTTCATTTGC 30 10 μM 43.33 59.93 9144.98 \

Gene Description

Target Gene GenBank ID
rcsA gene AY059955.1

Assay Description

Application Assay Primer Designing Software Reaction Time(min) Assay Temperature(℃) Readout System(s) Limit of Detection(LoD) Sensitivity(%) Specificity(%)
rapidly and accurately detect Kp and improved its performance through the optimization of each component. RPA-CRISPR\Cas12a Primer Premier 5 20 min 37°C CRISPR\Cas12a 1 fg/μL 100 % 100 %

Publication Description

Year of Publication Title Author(s) Journal PMID DOI
2024 A rapid and ultra-sensitive dual readout platform for Klebsiella pneumoniae detection based on RPA-CRISPR\Cas12a Meiying Tan,Lina Liang,Chuan Liao,Zihan Zhou,Shaoping Long,Xueli Yi,Chunfang Wang,Caiheng Wei,Jinyuan Cai,Xuebin Li,Guijiang Wei Frontiers in Cellular and Infection Microbiology 38994004 10.3389/fcimb.2024.1362513

A rapid and ultra-sensitive dual readout platform for Klebsiella pneumoniae detection based on RPA-CRISPR\Cas12a

Author(s):

Meiying Tan,Lina Liang,Chuan Liao,Zihan Zhou,Shaoping Long,Xueli Yi,Chunfang Wang,Caiheng Wei,Jinyuan Cai,Xuebin Li,Guijiang Wei

Journal:

Frontiers in Cellular and Infection Microbiology

Year:

2024

Abstract:

The bacterium Klebsiella pneumoniae (Kp) was the primary pathogen of hospital-acquired infection, but the current detection method could not rapidly and conveniently identify Kp. Recombinase polymerase amplification (RPA) was a fast and convenient isothermal amplification technology, and the clustered regularly interspaced short palindromic repeats (CRISPR) system could rapidly amplify the signal of RPA and improve its limit of detection (LOD). In this study, we designed three pairs of RPA primers for the rcsA gene of Kp, amplified the RPA signal through single-strand DNA reporter cleavage by CRISPR/Cas12a, and finally analyzed the cleavage signal using fluorescence detection (FD) and lateral flow test strips (LFTS). Our results indicated that the RPA-CRISPR/Cas12a platform could specifically identify Kp from eleven common clinical pathogens. The LOD of FD and LFTS were 1 fg/μL and 10 fg/μL, respectively. In clinical sample testing, the RPA-CRISPR/Cas12a platform was consistent with the culture method and qPCR method, and its sensitivity and specificity were 100% (16/16) and 100% (9/9), respectively. With the advantages of detection speed, simplicity, and accuracy, the RPA-CRISPR/Cas12a platform was expected to be a convenient tool for the early clinical detection of Kp.