RPB0247

Pathogen Description

Target Pathogen Pathogen Name NCBI Taxonomy ID Order Family Genus Species Pathogen type
SARS-CoV-2 SARS-CoV-2, 2019-nCoV, COVID-19, COVID-19 virus, SARS2, Wuhan coronavirus, Human coronavirus 2019, COVID19, HCoV-19, SARS-2, SARS-CoV4 2697049 Nidovirales Coronaviridae Betacoronavirus Severe acute respiratory syndrome-related coronavirus virus

Primer Description

Primer Name Sequence(5'-3') Length(bp) Primer Final Concentration(μM） GC Content（%） Predicted Melting Temperature(℃） Molecular Weight(g/moles) Positions in GenBank accession number
SARS-CoV-2 forward AAGCCTCTTCTCGTTCCTCATCACGTAG 28 10 μM 50 61.77 61.77 \
SARS-CoV-2 reverse GTTGGCCTTTACCAGACATTTTGCTCTCA 29 10 μM 44.83 61 8809.77 \
SARS-CoV-2 probe GGCGGTGATGCTGCTCTTGCTTTGCTGC-[T(FAM)]-G-dSpacer-[T(BHQ1)]-TGACAGATTGAACCAGC-Spacer C3 46 10 μM 56.52 74.44 14204.22 \

Gene Description

Target Gene GenBank ID
(N) gene NC_045512

Assay Description

Application Assay Primer Designing Software Reaction Time(min) Assay Temperature(℃) Readout System(s) Limit of Detection(LoD) Sensitivity(%) Specificity(%)
a rapid, duplexed, single-pot RT-RPA nucleic acid amplification assay with lateral flow readout for SARS-CoV-2 RPA-LFA PrimedRPA software 25 minutes 39 °C LFA \ 50 copies \

Publication Description

Year of Publication Title Author(s) Journal PMID DOI
2024 SARS-CoV-2 recombinase polymerase amplification assay with lateral flow readout and duplexed full process internal control Coleman D Martin,Andrew T Bender,Benjamin P Sullivan,Lorraine Lillis,David S Boyle,Jonathan D Posner Sensors & Diagnostics 38495597 10.1039/d3sd00246b

SARS-CoV-2 recombinase polymerase amplification assay with lateral flow readout and duplexed full process internal control

Author(s):

Coleman D Martin,Andrew T Bender,Benjamin P Sullivan,Lorraine Lillis,David S Boyle,Jonathan D Posner

Journal:

Sensors & Diagnostics

Year:

2024

Abstract:

Nucleic acid amplification tests for the detection of SARS-CoV-2 have been an important testing mechanism for the COVID-19 pandemic. While these traditional nucleic acid diagnostic methods are highly sensitive and selective, they are not suited to home or clinic-based uses. Comparatively, rapid antigen tests are cost-effective and user friendly but lack in sensitivity and specificity. Here we report on the development of a one-pot, duplexed reverse transcriptase recombinase polymerase amplification SARS-CoV-2 assay with MS2 bacteriophage as a full process control. Detection is carried out with either real-time fluorescence or lateral flow readout with an analytical sensitivity of 50 copies per reaction. Unlike previously published assays, the RNA-based MS2 bacteriophage control reports on successful operation of lysis, reverse transcription, and amplification. This SARS-CoV-2 assay features highly sensitive detection, visual readout through an LFA strip, results in less than 25 minutes, minimal instrumentation, and a useful process internal control to rule out false negative test results.