RPB0245

Pathogen Description

Target Pathogen Pathogen Name NCBI Taxonomy ID Order Family Genus Species Pathogen type
Klebsiella pneumoniae Klebsiella pneumoniae, Bacillus pneumoniae, Hyalococcus pneumoniae 573 Enterobacterales Enterobacteriaceae Klebsiella Klebsiella pneumoniae Bacterium

Primer Description

Primer Name Sequence(5'-3') Length(bp) Primer Final Concentration(μM） GC Content（%） Predicted Melting Temperature(℃） Molecular Weight(g/moles) Positions in GenBank accession number
F CACTGTACCTATTGTTGTGATTGTGCTCA 29 10 µM 41.38 58.48 8864.81 \
R ATTTCCTTAAAGACACTACCAACCGCTTT 29 10 µM 37.93 57.91 8755.78 \

Gene Description

Target Gene GenBank ID
P1 gene CP039761.1

Assay Description

Application Assay Primer Designing Software Reaction Time(min) Assay Temperature(℃) Readout System(s) Limit of Detection(LoD) Sensitivity(%) Specificity(%)
a rapid, simple, and accurate detection method for Mycoplasma pneumoniae RPA-CRISPR\Cas12a Primer Premier 5 40 min 37 °C CRISPR-Cas12a system 10²copies 100 % 100 %

Publication Description

Year of Publication Title Author(s) Journal PMID DOI
2024 Establishment of a rapid detection method for Mycoplasma pneumoniae based on RPA-CRISPR-Cas12a technology Ge Li,Jing Zhou,Nana Gao,Runde Liu,Jilu Shen Clinica Chimica Acta 39127296 10.1016/j.cca.2024.119906

Establishment of a rapid detection method for Mycoplasma pneumoniae based on RPA-CRISPR-Cas12a technology

Author(s):

Ge Li,Jing Zhou,Nana Gao,Runde Liu,Jilu Shen

Journal:

Clinica Chimica Acta

Year:

2024

Abstract:

Mycoplasma pneumoniae can cause respiratory infections and pneumonia, posing a serious threat to the health of children and adolescents. Early diagnosis of Mycoplasma pneumoniae infection is crucial for clinical treatment. Currently, diagnostic methods for Mycoplasma pneumoniae infection include pathogen detection, molecular biology techniques, and bacterial culture, all of which have certain limitations. Here, we developed a rapid, simple, and accurate detection method for Mycoplasma pneumoniae that does not rely on large equipment or complex operations. This technology combines the CRISPR-Cas12a system with recombinase polymerase amplification (RPA), allowing the detection results to be observed through fluorescence curves and immunochromatographic lateral flow strips.It has been validated that RPA-CRISPR/Cas12a fluorescence analysis and RPA-CRISPR/Cas12-immunochromatographic exhibit no cross-reactivity with other common pathogens, and The established detection limit was ascertained to be as low as 102 copies/µL.Additionally, 49 clinical samples were tested and compared with fluorescence quantitative polymerase chain reaction, demonstrating a sensitivity and specificity of 100%. This platform exhibits promising clinical performance and holds significant potential for clinical application, particularly in settings with limited resources, such as clinical care points or resource-constrained areas.