RPB0244

Pathogen Description

Target Pathogen Pathogen Name NCBI Taxonomy ID Order Family Genus Species Pathogen type
Streptococcus pyogenes M1 GAS Streptococcus pyogenes M1 GAS, Streptococcus pyogenes SF370, Streptococcus pyogenes ATCC 700294 160490 Lactobacillales Streptococcaceae Streptococcus Streptococcus pyogenes Bacterium

Primer Description

Primer Name Sequence(5'-3') Length(bp) Primer Final Concentration(μM) GC Content(%) Predicted Melting Temperature(℃) Molecular Weight(g/moles) Positions in GenBank accession number
F TCAATGGTAGCTCTTGTATCAGCCACAATGG 31 20 µM 45.16 61.75 9510.24 \
R AAAGAGTGCTGGAGTAATCTGACTAGTACCT 31 20 µM 41.94 59.55 9583.3 \

Gene Description

Target Gene GenBank ID
sdaB gene \

Assay Description

Application Assay Primer Designing Software Reaction Time(min) Assay Temperature(℃) Readout System(s) Limit of Detection(LoD) Sensitivity(%) Specificity(%)
robust, inexpensive, and appropriate for on-site testing.high specificity among different bacteria strains and extremely high sensitivity. RPA-LFB-Cas12a\crRNA \ 33 min 37°C Cas12 reaction and 3 min of lateral flow biosensor 10 copies \ \

Publication Description

Year of Publication Title Author(s) Journal PMID DOI
2024 A specific and ultrasensitive Cas12a\crRNA assay with recombinase polymerase amplification and lateral flow biosensor technology for the rapid detection of Streptococcus pyogenes Yu Cheng,Jiawen Lyu,Jiangfeng Han,Long Feng,Xiangmei Li,Pei Li,Shanfeng Zhang,Wenqiao Zang Clinical Microbiology 39254031 10.1128/spectrum.00345-24

A specific and ultrasensitive Cas12a\crRNA assay with recombinase polymerase amplification and lateral flow biosensor technology for the rapid detection of Streptococcus pyogenes

Author(s):

Yu Cheng,Jiawen Lyu,Jiangfeng Han,Long Feng,Xiangmei Li,Pei Li,Shanfeng Zhang,Wenqiao Zang

Journal:

Clinical Microbiology

Year:

2024

Abstract:

The potential of CRISPR/Cas systems for nucleic acid detection in novel biosensing applications is remarkable. The current clinical diagnostic detection of Streptococcus pyogenes (S. pyogenes) is based on serological identification, culture, and PCR. We report a rapid, simple, and sensitive method for detecting and screening for S. pyogenes. This novel method is a promising supplemental test. After 10 min of the sample processing and 10 min of recombinase polymerase amplification, followed by 10 min of Cas12 reaction and 3 min of lateral flow biosensor (LFB) readout, a visible outcome can be observed without the need for magnification within 33 min. This platform is robust, inexpensive, and appropriate for on-site testing. A new technique for detection was created using CRISPR-Cas12a technology, which includes two measurements: a fluorescent-CRISPR-S. pyogenes test and a LFB-CRISPR-S. pyogenes test. An approach utilizing CRISPR Cas12a was developed, and the accuracy and precision of this technique were assessed. The LoD for the fluorescence-CRISPR- S. pyogenes assay was 1 copy/μL, and the technique effectively differentiated S. pyogenes from other microorganisms. Moreover, the detection outcomes were presented in a user-friendly manner using lateral flow biosensor strips. Conclusion: A rapid and sensitive Cas12a/crRNA assay using recombinase RPA and LFB was developed to detect S. pyogenes. The Cas12a/crRNA-based assay exhibited high specificity among different bacteria strains and extremely high sensitivity. The accuracy and rapidity of this method make it a promising tool for S. pyogenes detection and screening. Importance: Patients may experience a range of symptoms due to Streptococcus pyogenes infections, including superficial skin infections, pharyngitis, and invasive diseases in subcutaneous tissues like streptococcal toxic shock syndrome. At present, the clinical diagnostic detection of S. pyogenes is based on serological identification, culture, and PCR. These detection methods are time-consuming and require sophisticated equipment, making these methods challenging for routine laboratories. Thus, there is a need for a detection platform that is capable of quickly and accurately identifying S. pyogenes. In this study, a rapid and sensitive Cas12a/crRNA assay using recombinase RPA and LFB was developed to detect S. pyogenes. The Cas12a/crRNA-based assay exhibited high specificity among different bacteria strains and extremely high sensitivity. This method probably plays an important role for S. pyogenes detection and screening.