RPB0243

Pathogen Description

Target Pathogen Pathogen Name NCBI Taxonomy ID Order Family Genus Species Pathogen type
Measles morbillivirus Measles morbillivirus, Cell-associated subacute sclerosing panencephalitis, Measles virus, Subacute sclerosing panencephalitis virus, measles virus MV, rougeole virus rubeola virus, subacute sclerose panencephalitis virus, subacute sclerosing panencephalitis virus, SSPEV 11234 Mo\gavirales Paramyxoviridae Morbillivirus Measles morbillivirus Virus

Primer Description

Primer Name Sequence(5'-3') Length(bp) Primer Final Concentration(μM） GC Content（%） Predicted Melting Temperature(℃） Molecular Weight(g/moles) Positions in GenBank accession number
Meas_NS1 CAAAGGCGGTTACGGCYCCAGACACRGCAGCTGAT 35 10μM 60 72.86 10775.54 643-677
Meas_NR1 ACCACATCCAACCATTTTCTCTCCAATCTAAATTC 35 10μM 37.14 59.49 10488.91 763-729
Meas_Probe AATCTAAATTCACCAACTACCCTTCTTTGT(dT-FAM)G(THF)G(dT-BHQ)GTAYTTTATCCACC-(C3) 46 10μM 38.04 63.43 13936.62 735-691

Gene Description

Target Gene GenBank ID
N region NC_001498

Assay Description

Application Assay Primer Designing Software Reaction Time(min) Assay Temperature(℃) Readout System(s) Limit of Detection(LoD) Sensitivity(%) Specificity(%)
simple visual detection of measles virus RT-RPA CRISPR\Cas12a-LFD Clustal W less than 1 h 42°C CRISPR\Cas12a-LFD 31 copies 0.96 100 %

Publication Description

Year of Publication Title Author(s) Journal PMID DOI
2024 Rapid Detection of Measles Virus Using Reverse Transcriptase\Recombinase Polymerase Amplification Coupled with CRISPR\Cas12a and a Lateral Flow Detection: A Proof-of-Concept Study Elena Pinchon,Steven Henry,Fanny Leon,Chantal Fournier-Wirth,Vincent Foulongne,Jean-François Cantaloube Diagnostics 38472989 10.3390/diagnostics14050517

Rapid Detection of Measles Virus Using Reverse Transcriptase\Recombinase Polymerase Amplification Coupled with CRISPR\Cas12a and a Lateral Flow Detection: A Proof-of-Concept Study

Author(s):

Elena Pinchon,Steven Henry,Fanny Leon,Chantal Fournier-Wirth,Vincent Foulongne,Jean-François Cantaloube

Journal:

Diagnostics

Year:

2024

Abstract:

The measles virus is highly contagious, and efforts to simplify its diagnosis are essential. A reverse transcriptase/recombinase polymerase amplification assay coupled with CRISPR/Cas12a and an immunochromatographic lateral flow detection (RT-RPA-CRISPR-LFD) was developed for the simple visual detection of measles virus. The assay was performed in less than 1 h at an optimal temperature of 42 °C. The detection limit of the assay was 31 copies of an RNA standard in the reaction tube. The diagnostic performances were evaluated on a panel of 27 measles virus RT-PCR-positive samples alongside 29 measles virus negative saliva samples. The sensitivity and specificity were 96% (95% CI, 81-99%) and 100% (95% CI, 88-100%), respectively, corresponding to an accuracy of 98% (95% CI, 94-100%; p < 0.0001). This method will open new perspectives in the development of the point-of-care testing diagnosis of measles.