RPB0234

Pathogen Description

Target Pathogen Pathogen Name NCBI Taxonomy ID Order Family Genus Species Pathogen type
SARS-CoV-2 SARS-CoV-2, 2019-nCoV, COVID-19, COVID-19 virus, SARS2, Wuhan coronavirus, Human coronavirus 2019, COVID19, HCoV-19, SARS-2, SARS-CoV4 2697049 Nidovirales Coronaviridae Betacoronavirus Severe acute respiratory syndrome-related coronavirus virus

Primer Description

Primer Name Sequence(5'-3') Length(bp) Primer Final Concentration(μM） GC Content（%） Predicted Melting Temperature(℃） Molecular Weight(g/moles) Positions in GenBank accession number
SARS-CoV-2 WT forward PCR primer GGGAGCCTTGAATACACCAAAA 22 0.34μM 45.45 55.18 6761.49 \
SARS-CoV-2 WT reverse PCR primer GAAGTTGTAGCACGATTGCAG 21 0.34μM 47.62 54.16 6510.3 \

Gene Description

Target Gene GenBank ID
Nucleocapsid N3 gene NC_045512.2

Assay Description

Application Assay Primer Designing Software Reaction Time(min) Assay Temperature(℃) Readout System(s) Limit of Detection(LoD) Sensitivity(%) Specificity(%)
PACRAT enables rapid, highly sensitive, fluorometric detection of pathogenic RNA, allowing quantitative analysis of PACRAT reactions by fluorescence. PACRAT \ 10 min 39°C PACRAT 4.5 copies \ \

Publication Description

Year of Publication Title Author(s) Journal PMID DOI
2024 PACRAT: pathogen detection with aptamer-observed cascaded recombinase polymerase amplification–in vitro transcription Pavana Khan,Lauren M Aufdembrink,Katarzyna P Adamala,Aaron E Engelhart RNA 38637016 10.1261/rna.079891.123

PACRAT: pathogen detection with aptamer-observed cascaded recombinase polymerase amplification–in vitro transcription

Author(s):

Pavana Khan,Lauren M Aufdembrink,Katarzyna P Adamala,Aaron E Engelhart

Journal:

RNA

Year:

2024

Abstract:

The SARS-CoV-2 pandemic underscored the need for early, rapid, and widespread pathogen detection tests that are readily accessible. Many existing rapid isothermal detection methods use the recombinase polymerase amplification (RPA), which exhibits polymerase chain reaction (PCR)-like sensitivity, specificity, and even higher speed. However, coupling RPA to other enzymatic reactions has proven difficult. For the first time, we demonstrate that with tuning of buffer conditions and optimization of reagent concentrations, RPA can be cascaded into an in vitro transcription reaction, enabling detection using fluorescent aptamers in a one-pot reaction. We show that this reaction, which we term PACRAT (pathogen detection with aptamer-observed cascaded recombinase polymerase amplification-in vitro transcription) can be used to detect SARS-CoV-2 RNA with single-copy detection limits, Escherichia coli with single-cell detection limits, and 10-min detection times. Further demonstrating the utility of our one-pot, cascaded amplification system, we show PACRAT can be used for multiplexed detection of the pathogens SARS-CoV-2 and E. coli, along with multiplexed detection of two variants of SARS-CoV-2.