RPB0228

Pathogen Description

Target Pathogen Pathogen Name NCBI Taxonomy ID Order Family Genus Species Pathogen type
Pseudomonas aeruginosa Pseudomonas aeruginosa, Bacterium aeruginosum, Bacillus aeruginosus 287 Pseudomonadales Pseudomonadaceae Pseudomonas Pseudomonas aeruginosa Bacterium

Primer Description

Primer Name Sequence(5'-3') Length(bp) Primer Final Concentration(μM） GC Content（%） Predicted Melting Temperature(℃） Molecular Weight(g/moles) Positions in GenBank accession number
lasB-F GAAGGTTTCTACGCTTGACCTGTTGTTCGT 30 20μM 46.67 62.28 9210.02 \
lasB-R GTTGTGGAATTGCTCGTAGCGGGTGACCTG 30 20μM 56.67 67.01 9325.08 \

Gene Description

Target Gene GenBank ID
lasB gene \

Assay Description

Application Assay Primer Designing Software Reaction Time(min) Assay Temperature(℃) Readout System(s) Limit of Detection(LoD) Sensitivity(%) Specificity(%)
Rapid, sensitive, and user-friendly detection of Pseudomonas aeruginosa RPA\CRISPR\Cas12a system \ approximately 30 39℃ CRISPR\Cas12a detection 10⁰ copies \ \

Publication Description

Year of Publication Title Author(s) Journal PMID DOI
2024 Rapid, sensitive, and user-friendly detection of Pseudomonas aeruginosa using the RPA\CRISPR\Cas12a system Wenjing Zhang,Hai Qu,Xin Wu,Jingjing Shi,Xinling Wang BMC microbiology 38689239 10.1186/s12879-024-09348-3

Rapid, sensitive, and user-friendly detection of Pseudomonas aeruginosa using the RPA\CRISPR\Cas12a system

Author(s):

Wenjing Zhang,Hai Qu,Xin Wu,Jingjing Shi,Xinling Wang

Journal:

BMC microbiology

Year:

2024

Abstract:

Background: Pseudomonas aeruginosa (P. aeruginosa) is a life-threatening bacterium known for its rapid development of antibiotic resistance, posing significant challenges in clinical treatment, biosecurity, food safety, and environmental monitoring. Early and accurate identification of P. aeruginosa is crucial for effective intervention. Methods: The lasB gene of P. aeruginosa was selected as the target for the detection. RPA primers for recombinase polymerase amplification (RPA) and crRNA for CRISPR/Cas12a detection were meticulously designed to target specific regions within the lasB gene. The specificity of the RPA/CRISPR/Cas12a detection platform was assessed using 15 strains. The detection limit of RPA/CRISPR/Cas12a detection platform was determined by utilizing a pseudo-dilution series of the P. aeruginosa DNA. The practical applicability of the RPA/CRISPR/Cas12a detection platform was validated by comparing it with qPCR on 150 samples (35 processed meat product samples, 55 cold seasoned vegetable dishes, 60 bottled water samples). Results: The RPA/CRISPR/Cas12a detection platform demonstrates high specificity, with no cross-reactivity with non-P. aeruginosa strains. This assay exhibits remarkable sensitivity, with a limit of detection (LOD) of 100 copies/µL for fluorescence assay and 101 copies/µL for the LFTS method. Furthermore, the performance of the RPA/CRISPR/Cas12a detection platform is comparable to that of the well-established qPCR method, while offering advantages such as shorter reaction time, simplified operation, and reduced equipment requirements. Conclusions: The RPA/CRISPR/Cas12a detection platform presents a straightforward, accurate, and sensitive approach for early P. aeruginosa detection and holds great promise for diverse applications requiring rapid and reliable identification.