| Target Pathogen | Pathogen Name | NCBI Taxonomy ID | Order | Family | Genus | Species | Pathogen type |
|---|---|---|---|---|---|---|---|
| SARS-CoV-2 | SARS-CoV-2, 2019-nCoV, COVID-19, COVID-19 virus, SARS2, Wuhan coronavirus, Human coronavirus 2019, COVID19, HCoV-19, SARS-2, SARS-CoV4 | 2697049 | Nidovirales | Coronaviridae | Betacoronavirus | Severe acute respiratory syndrome-related coronavirus | virus |
| Primer Name | Sequence(5'-3') | Length(bp) | Primer Final Concentration(μM） | GC Content（%） | Predicted Melting Temperature(℃） | Molecular Weight(g/moles) | Positions in GenBank accession number |
|---|---|---|---|---|---|---|---|
| N-F | GGGGAACTTCTCCTGCTAGAAT | 22 | \ | 50 | 56.29 | 6750.45 | \ |
| N-R | CAGACATTTTGCTCTCAAGCTG | 22 | \ | 45.5 | 54.18 | 6685.41 | \ |
| Application | Assay | Primer Designing Software | Reaction Time(min) | Assay Temperature(℃) | Readout System(s) | Limit of Detection(LoD) | Sensitivity(%) | Specificity(%) |
|---|---|---|---|---|---|---|---|---|
| \ | RPA | \ | 20 | 36.4±0.2°C | electrochemical detection | 3.925 fg/μL | \ | \ |
| Year of Publication | Title | Author(s) | Journal | PMID | DOI | ||
|---|---|---|---|---|---|---|---|
| 2021 | Sensitive electrochemical biosensor combined with isothermal amplification for point-of-care COVID-19 tests | Hyo Eun Kim, Ariadna Schuck, See Hi Lee, Yunjong Lee, Minhee Kang, and Yong-Sang Kim | Biosensors and Bioelectronics | 33780853 | 10.1016/j.bios.2021.113168 | ||
Sensitive electrochemical biosensor combined with isothermal amplification for point-of-care COVID-19 testsAuthor(s):Hyo Eun Kim, Ariadna Schuck, See Hi Lee, Yunjong Lee, Minhee Kang, and Yong-Sang KimJournal:Biosensors and BioelectronicsYear:2021Abstract:We report an electrochemical biosensor combined with recombinase polymerase amplification (RPA) for rapid and sensitive detection of severe acute respiratory syndrome coronavirus 2. The electrochemical biosensor based on a multi-microelectrode array allows the detection of multiple target genes by differential pulse voltammetry. The RPA reaction involves hybridization of the RPA amplicon with thiol-modified primers immobilized on the working electrodes, which leads to a reduction of current density as amplicons accumulate. The assay results in shorter “sample-to-answer” times than conventional PCR without expensive thermo-cycling equipment. The limits of detection are about 0.972 fg/μL (RdRP gene) and 3.925 fg/μL (N gene), which are slightly lower than or comparable to that of RPA assay results obtained by gel electrophoresis without post-amplification purification. The combination of electrochemical biosensors and the RPA assay is a rapid, sensitive, and convenient platform that can be potentially used as a point-of-care test for the diagnosis of COVID-19.PMID:33780853
|
|||||||