RPB0199

Pathogen Description

Target Pathogen Pathogen Name NCBI Taxonomy ID Order Family Genus Species Pathogen type
SARS-CoV-2 SARS-CoV-2, 2019-nCoV, COVID-19, COVID-19 virus, SARS2, Wuhan coronavirus, Human coronavirus 2019, COVID19, HCoV-19, SARS-2, SARS-CoV4 2697049 Nidovirales Coronaviridae Betacoronavirus Severe acute respiratory syndrome-related coronavirus virus

Primer Description

Primer Name Sequence(5'-3') Length(bp) Primer Final Concentration(μM） GC Content（%） Predicted Melting Temperature(℃） Molecular Weight(g/moles) Positions in GenBank accession number
SARS-CoV-2 N-gene RPA-F AGACGTGGTCCAGAACAAACCCAAGGAAATT 31 0.24 45.2 63.35 9555.31 \
SARS-CoV-2 N-gene RPA-R TGTGTAGGTCAACCACGTTCCCGAAGGTGT 30 0.24 53.3 66.8 9238.04 \

Gene Description

Target Gene GenBank ID
N-gene \

Assay Description

Application Assay Primer Designing Software Reaction Time(min) Assay Temperature(℃) Readout System(s) Limit of Detection(LoD) Sensitivity(%) Specificity(%)
\ One-Pot RPA-CRISPR/Cas12a \ 60 37 Fluorometric detection (Fluorescent metal ion indicator (Calcein)) 10 copies 100 100

Publication Description

Year of Publication Title Author(s) Journal PMID DOI
2022 Glycerol Additive Boosts 100-fold Sensitivity Enhancement for One-Pot RPA-CRISPR/Cas12a Assay Mei Lin , Huahua Yue , Tian Tian , Erhu Xiong , Debin Zhu , Yongzhong Jiang , Xiaoming Zhou Analytical Chemistry 35635176 10.1021/acs.analchem.2c00616

Glycerol Additive Boosts 100-fold Sensitivity Enhancement for One-Pot RPA-CRISPR/Cas12a Assay

Author(s):

Mei Lin , Huahua Yue , Tian Tian , Erhu Xiong , Debin Zhu , Yongzhong Jiang , Xiaoming Zhou

Journal:

Analytical Chemistry

Year:

2022

Abstract:

CRISPR/Cas12, a highly efficient and specific nucleic acid recognition system, has been broadly employed to detect amplified DNA products. However, most reported methods adopt a two-step detection mode that needs a liquid transfer step, thus complicating the detection procedure and posing a risk of aerosol contamination. A one-pot detection method can obviate these problems, but it suffers from poor detection efficiency due to the loss of amplification templates elicited by CRISPR/Cas12 cleavage. In this study, we discovered that a glycerol additive dramatically promoted the detection efficiency of the one-pot recombinase polymerase amplification (RPA)-CRISPR/Cas12a method. Compared with the glycerol-free version, its sensitivity was nearly 100-fold higher and was close to that of the canonical two-step method. Further investigation displayed that the enhanced detection efficiency was attributed to the phase separation of the RPA and CRISPR/Cas12a system during the initial phase of the RPA reaction caused by the glycerol viscosity. This highly efficient one-pot method has been triumphantly harnessed for the detection of African swine fever virus (ASFV) and SARS-CoV-2, achieving naked-eye readout through a smartphone-equipped device. The currently developed glycerol-enhanced one-pot RPA-CRISPR/Cas12a method can be an advantageous point-of-care nucleic acid detection platform on account of its simplicity, high sensitivity, and universality.