RPB0177

Pathogen Description

Target Pathogen Pathogen Name NCBI Taxonomy ID Order Family Genus Species Pathogen type
Klebsiella pneumoniae Klebsiella pneumoniae, Bacillus pneumoniae, Hyalococcus pneumoniae 573 Enterobacterales Enterobacteriaceae Klebsiella Klebsiella pneumoniae Bacterium

Primer Description

Primer Name Sequence(5'-3') Length(bp) Primer Final Concentration(μM） GC Content（%） Predicted Melting Temperature(℃） Molecular Weight(g/moles) Positions in GenBank accession number
F TTATCCCGACAGCCCGGAGCGTTTTTCGATTGG 33 0.42 54.5 68.64 10111.59 150–351
R CAGCTTCCAGAGATAGCCGTTTATCCACACTTCCG 35 0.42 51.4 66.07 10626.95 150–351
P CACGCGGAGAGCGATGAGGAAGAGT(FAM)CH(BHQ)CTACGTGCTGGAGGGC 43 0.12 63.6 75.92 13421.73 150–351

Gene Description

Target Gene GenBank ID
khe AF293352

Assay Description

Application Assay Primer Designing Software Reaction Time(min) Assay Temperature(℃) Readout System(s) Limit of Detection(LoD) Sensitivity(%) Specificity(%)
\ RPA The National Center for Biotechnology Information’s (NCBI) BLAST tool 20 42 \ 100copies/reaction 83 100

Publication Description

Year of Publication Title Author(s) Journal PMID DOI
2017 Development of a Panel of Recombinase Polymerase Amplification Assays for Detection of Common Bacterial Urinary Tract Infection Pathogens Balakrishnan Raja,Heather J. Goux, Archana Marapadaga, Sri Rajagopalan, Katerina Kourentzi, and Richard C. Willson Journal of Applied Microbiology 28510991 10.1111/jam.13493

Development of a Panel of Recombinase Polymerase Amplification Assays for Detection of Common Bacterial Urinary Tract Infection Pathogens

Author(s):

Balakrishnan Raja,Heather J. Goux, Archana Marapadaga, Sri Rajagopalan, Katerina Kourentzi, and Richard C. Willson

Journal:

Journal of Applied Microbiology

Year:

2017

Abstract:

Aims To develop and evaluate the performance of a panel of isothermal real-time recombinase polymerase amplification (RPA) assays for detection of common bacterial urinary tract infection (UTI) pathogens. Methods and Results The panel included RPAs for Escherichia coli, Klebsiella pneumoniae, Proteus mirabilis, Pseudomonas aeruginosa, and Enterococcus faecalis. All five RPAs required reaction times of under 12 minutes to reach their lower limit of detection of 100 genomes per reaction or less, and did not cross-react with high concentrations of non-target bacterial genomic DNA. In a 50-sample retrospective clinical study, the five-RPA assay panel was found to have a specificity of 100% (95% CI, 78%-100%) and a sensitivity of 89% (95% CI, 75%-96%) for UTI detection. Conclusions The analytical and clinical validity of RPA for the rapid and sensitive detection of common UTI pathogens was established. Significance and Impact Rapid identification of the causative pathogens of urinary tract infections (UTIs) can be valuable in preventing serious complications by helping avoid the empirical treatment necessitated by traditional urine culture’s 48–72 hour turnaround time. The routine and widespread use of RPA to supplement or replace culture-based methods could profoundly impact UTI management and the emergence of multidrug-resistant pathogens.