RPB0171

Pathogen Description

Target Pathogen Pathogen Name NCBI Taxonomy ID Order Family Genus Species Pathogen type
HCoV-NL63 Human coronavirus NL63, Coronavirus NL63, Human coronavirus NL 27794 Nidovirales Coronaviridae Alphacoronavirus Human coronavirus NL63 Virus

Primer Description

Primer Name Sequence(5'-3') Length(bp) Primer Final Concentration(μM) GC Content(%) Predicted Melting Temperature(℃) Molecular Weight(g/moles) Positions in GenBank accession number
F TCAGAATGGTGTTGATGCCAAAGGTTTT 28 \ 39.3 58.87 8673.7 \
R ACAAGCATTTTGTAGGTGTAGGTAATCT 28 \ 35.7 55.41 8657.7 \
P CAGGCTGCGTTATTCTTTGATAGTGAGGT[-dT-FAM-][-dSpacer-]G[-BMN-Q535-]CACTGATGAAGTGGGTGA[-C3-spacer] 48 \ 47.9 69.7 14964.73 \

Gene Description

Target Gene GenBank ID
N-gene \

Assay Description

Application Assay Primer Designing Software Reaction Time(min) Assay Temperature(℃) Readout System(s) Limit of Detection(LoD) Sensitivity(%) Specificity(%)
\ RT-RPA biomers.net (biomers.net GmbH) 20 42 \ 13 RNA molecules/reaction \ \

Publication Description

Year of Publication Title Author(s) Journal PMID DOI
2022 Rapid detection of human coronavirus NL63 by isothermal reverse transcription recombinase polymerase amplification Aline Dorendorf,Iris Bachmann,Martin Spiegel,Ahmed Abd El Wahed,Gregory Dame,Frank Hufert Journal of clinical virology plus 36248766 10.1016/j.jcvp.2022.100115

Rapid detection of human coronavirus NL63 by isothermal reverse transcription recombinase polymerase amplification

Author(s):

Aline Dorendorf,Iris Bachmann,Martin Spiegel,Ahmed Abd El Wahed,Gregory Dame,Frank Hufert

Journal:

Journal of clinical virology plus

Year:

2022

Abstract:

Background: Human coronaviruses are one of the leading causes for respiratory tract infections and for frequent primary care consultation. The human coronavirus NL63 (HCoV..µNL63) is one representative of the seasonal coronaviruses and capable of infecting the upper and lower respiratory tract and causative agent for croup in children. Objectives: For fast detection of HCoV-NL63, we developed an isothermal reverse transcription recombinase polymerase amplification (RT-RPA) assay. Study design: The analytical sensitivities of the RT-RPA assay were identified for in vitro transcribed ribonucleic acid (RNA) and for genomic viral RNA from cell culture supernatant. Moreover, specificity was tested with nucleic acids from other human coronaviruses and a variety of clinically relevant respiratory viruses. Finally, a clinical nasopharyngeal swab sample with spiked genomic viral HCoV-NL63 RNA was analyzed. Results: Our HCoV-NL63 RT-RPA assay is highly specific and has an analytical sensitivity of 13 RNA molecules/reaction for in vitro transcribed RNA. For genomic viral RNA from cell culture supernatant spiked into a clinical nasopharyngeal swab sample the assay...s analytical sensitivity is 170 RNA molecules/reaction. The assay shows amplification of the lowest detectable target copy number after 8 minutes and 7 minutes, respectively. Conclusions: We were able to design a sensitive and specific RT-RPA assay for the detection of HCoV-NL63. Additionally, the assay is characterized by short duration, isothermal amplification, and simple instrumentation.