| Target Pathogen | Pathogen Name | NCBI Taxonomy ID | Order | Family | Genus | Species | Pathogen type |
|---|---|---|---|---|---|---|---|
| Staphylococcus aureus | Staphylococcus aureus, Micrococcus aureus, Staphylococcus pyogenes aureus | 1280 | Bacillales | Staphylococcaceae | Staphylococcus | Staphylococcus aureus | Bacterium |
| Primer Name | Sequence(5'-3') | Length(bp) | Primer Final Concentration(μM） | GC Content（%） | Predicted Melting Temperature(℃） | Molecular Weight(g/moles) | Positions in GenBank accession number |
|---|---|---|---|---|---|---|---|
| primers F3 | ATGAATCAGCTCCACAGAGTACAGATGCAAGTA | 33 | 0.36 | 42.4 | 61.68 | 10163.7 | \ |
| primers B3 | CTCCAGAGTCAATACCAACTGTCACATTCGTCA | 33 | 0.36 | 45.5 | 62.52 | 10001.57 | \ |
| Application | Assay | Primer Designing Software | Reaction Time(min) | Assay Temperature(℃) | Readout System(s) | Limit of Detection(LoD) | Sensitivity(%) | Specificity(%) |
|---|---|---|---|---|---|---|---|---|
| testing for Staphylococcus aureus | RPA | Primer Premier 5.0 | 5 | 37 | SYBR Green Ι | 10¹ CFU/reaction | \ | \ |
| Year of Publication | Title | Author(s) | Journal | PMID | DOI | ||
|---|---|---|---|---|---|---|---|
| 2021 | Rapid, visual, and equipment-free point-of-care testing for Staphylococcus aureus by direct recombinase polymerase amplification with SYBR Green Ι | Xiaorui Fan,Fangti Han,Binan Zhao,Yan Xu,Xiao Zhao,Xinyi Pu,Yanan Du,Qi Zhang,Xiaoxia Zhang,Wanjing Zhang,Wenjing Wu,Zhiwei Chen,Kai Zhao | Acta biochimica et biophysica Sinica | 34212180 | 10.1093/abbs/gmab091 | ||
Rapid, visual, and equipment-free point-of-care testing for Staphylococcus aureus by direct recombinase polymerase amplification with SYBR Green ΙAuthor(s):Xiaorui Fan,Fangti Han,Binan Zhao,Yan Xu,Xiao Zhao,Xinyi Pu,Yanan Du,Qi Zhang,Xiaoxia Zhang,Wanjing Zhang,Wenjing Wu,Zhiwei Chen,Kai ZhaoJournal:Acta biochimica et biophysica SinicaYear:2021Abstract:No abstract available.PMID:34212180
|
|||||||