RPB0163

Pathogen Description

Target Pathogen Pathogen Name NCBI Taxonomy ID Order Family Genus Species Pathogen type
Staphylococcus aureus Staphylococcus aureus, Micrococcus aureus, Staphylococcus pyogenes aureus 1280 Bacillales Staphylococcaceae Staphylococcus Staphylococcus aureus Bacterium

Primer Description

Primer Name Sequence(5'-3') Length(bp) Primer Final Concentration(μM） GC Content（%） Predicted Melting Temperature(℃） Molecular Weight(g/moles) Positions in GenBank accession number
LF‐F CTTATAGGGATGGCTATCAGTAATGTTTCG 30 0.42 40 56.34 9267.08 \
LF‐R biotin‐TCTATTTACGCCATTATCTGTTTGTGATGC 31 0.42 36.7 56.64 9143.99 \
LF‐P FAM‐ACGCAAAGAGGTTTTTCTATTTCGCTACTA‐(THF)‐TTGTTTAGTGTTAAC‐spacer C3 45 0.12 33.3 60.82 13821.03 \

Gene Description

Target Gene GenBank ID
nuc CP030138.1

Assay Description

Application Assay Primer Designing Software Reaction Time(min) Assay Temperature(℃) Readout System(s) Limit of Detection(LoD) Sensitivity(%) Specificity(%)
detection of Staphylococcus aureus in milk RPA-LF \ 10 39 lateral flow (LF) strips 1 × 10³ CFU ml-1 (40 CFU per reaction) \ \

Publication Description

Year of Publication Title Author(s) Journal PMID DOI
2022 Rapid and visual detection of Staphylococcus aureus in milk using a recombinase polymerase amplification-lateral flow assay combined with immunomagnetic separation Ya-Lei Wang,Xin Zhang,Quan Wang,Peng-Xuan Liu,Wei Tang,Rong Guo,Hai-Yang Zhang,Zhao-Guo Chen,Xian-Gan Han,Wei Jiang Journal of applied microbiology 36073301 10.1111/jam.15811

Rapid and visual detection of Staphylococcus aureus in milk using a recombinase polymerase amplification-lateral flow assay combined with immunomagnetic separation

Author(s):

Ya-Lei Wang,Xin Zhang,Quan Wang,Peng-Xuan Liu,Wei Tang,Rong Guo,Hai-Yang Zhang,Zhao-Guo Chen,Xian-Gan Han,Wei Jiang

Journal:

Journal of applied microbiology

Year:

2022

Abstract:

Aims: The aim of this study was to develop a novel approach using lateral flow recombinase polymerase amplification (RPA-LF) combined with immunomagnetic separation (IMS) for the rapid detection of Staphylococcus aureus in milk. Methods and results: Under optimum conditions, the average capture efficiency values for S. aureus strains (104 colony-forming units [CFU] per ml) was above 95.0% in PBST and ~80% in milk within 45 min with 0.7 mg immunomagnetic beads. The RPA-LF assay, which comprised DNA amplification via RPA at 39°C for 10 min and visualization of the amplicons through LF strips for 5 min, detected S. aureus within 15 min. The method only detected S. aureus and did not show cross-reaction with other bacteria, exhibiting a high level of specificity. Sensitivity experiments confirmed a detection limit of RPA-LF assay as low as 600 fg per reaction for the S. aureus genome (corresponding to approximately 36 CFU of S. aureus), which was about 16.7-fold more sensitive than that of the conventional polymerase chain reaction method. When RPA-LF was used in combination with IMS to detect S. aureus inoculated into artificially contaminated milk, it exhibited a detection limit of approximately 40 CFU per reaction. Conclusions: The newly developed IMS-RPA-LF method enabled detection of S. aureus at levels as low as 40 CFU per reaction in milk samples without culture enrichment for an overall testing time of only 70 min. Significance and impact of the study: The newly developed IMS-lateral flow RPA-LF assay effectively combines sample preparation, amplification and detection into a single platform. Because of its high sensitivity, specificity and speed, the IMS-RPA-LF assay will have important implications for the rapid detection of S. aureus in contaminated food.