RPB0157

Pathogen Description

Target Pathogen Pathogen Name NCBI Taxonomy ID Order Family Genus Species Pathogen type
Staphylococcus aureus Staphylococcus aureus, Micrococcus aureus, Staphylococcus pyogenes aureus 1280 Bacillales Staphylococcaceae Staphylococcus Staphylococcus aureus Bacterium

Primer Description

Primer Name Sequence(5'-3') Length(bp) Primer Final Concentration(μM) GC Content(%) Predicted Melting Temperature(℃) Molecular Weight(g/moles) Positions in GenBank accession number
mecA-F GCGATAATGGTGAAGTAGAAATGACTGAACGTCCG 35 0.48 45.7 63.05 10893.15 \
mecA-R TTGAACGTTGCGATCAATGTTACCGTAGTTTG 32 0.48 40.6 60.49 9860.46 \

Gene Description

Target Gene GenBank ID
mecA \

Assay Description

Application Assay Primer Designing Software Reaction Time(min) Assay Temperature(℃) Readout System(s) Limit of Detection(LoD) Sensitivity(%) Specificity(%)
detection of methicillin-resistant Staphylococcus aureus RPA-LF \ 20 45 amplification-lateral flow strip 1 CFU 1 0.977

Publication Description

Year of Publication Title Author(s) Journal PMID DOI
2022 Rapid detection of methicillin-resistant Staphylococcus aureus in positive blood-cultures by recombinase polymerase amplification combined with lateral flow strip Arpasiri Srisrattakarn,Pimchanok Panpru,Patcharaporn Tippayawat,Aroonwadee Chanawong,Ratree Tavichakorntrakool,Jureerut Daduang,Lumyai Wonglakorn,Aroonlug Lulitanond PloS one 35771885 10.1371/journal.pone.0270686

Rapid detection of methicillin-resistant Staphylococcus aureus in positive blood-cultures by recombinase polymerase amplification combined with lateral flow strip

Author(s):

Arpasiri Srisrattakarn,Pimchanok Panpru,Patcharaporn Tippayawat,Aroonwadee Chanawong,Ratree Tavichakorntrakool,Jureerut Daduang,Lumyai Wonglakorn,Aroonlug Lulitanond

Journal:

PloS one

Year:

2022

Abstract:

Staphylococcus aureus, especially methicillin-resistant S. aureus (MRSA), is an important bacterium that causes community and healthcare-related infections throughout the world. However, the current conventional detection methods are time-consuming. We therefore developed and evaluated a recombinase polymerase amplification-lateral flow strip (RPA-LF) approach for detection of MRSA in positive blood-culture samples. Sixty positive blood-cultures from a hospital were tested directly without DNA extraction and purification before the amplification reaction. RPA primers and probes were designed for nuc (encoding thermonuclease) and mecA (encoding penicillin-binding protein 2a) genes to diagnose S. aureus and its methicillin-resistance status. The RPA reaction occurred under isothermal conditions (45°C) within 20 min and a result was provided by the LF strip in a further 5 min at room temperature. The evaluation of RPA-LF using blood-culture samples showed 93.3% (14/15) sensitivity for identifying S. aureus, and no cross-amplification was seen [100% (45/45) specificity]. For detection of methicillin resistance, the RPA-LF test provided 100% (16/16) sensitivity and 97.7% (43/44) specificity. The RPA-LF is rapid, highly sensitive, robust and easy to use. It can be used for direct detection of MRSA with no requirement for special equipment.