RPB0129

Pathogen Description

Target Pathogen Pathogen Name NCBI Taxonomy ID Order Family Genus Species Pathogen type
RSV A/B Respiratory syncytial virus, Respiratory syncytial virus RS, respiratory syncytial virus RS virus, Respiratory syncytial virus RSV 12814 Mo\gavirales Pneumoviridae Orthopneumovirus Bovine orthopneumovirus Virus

Primer Description

Primer Name Sequence(5'-3') Length(bp) Primer Final Concentration(μM) GC Content(%) Predicted Melting Temperature(℃) Molecular Weight(g/moles) Positions in GenBank accession number
f1 ATACACTATTCAACGTAGTACAGGAGA 27 0.42 37 53.99 8300.5 \
r1 TGAATTTATGATTTGCATCTTCAGTGATT 29 0.42 27.6 52.42 8902.86 \
probe TAATAGCATACCACATAGTTTGTTTAGGTG(FAM-dT)(THF)(BHQ1-dT)TTGCACATCATAATT(C3-spacer) 45 0.12 31.1 60.14 13823.06 \

Gene Description

Target Gene GenBank ID
(N) gene \

Assay Description

Application Assay Primer Designing Software Reaction Time(min) Assay Temperature(℃) Readout System(s) Limit of Detection(LoD) Sensitivity(%) Specificity(%)
etection of human respiratory syncytial virus Real-time RT-RPA \ 20 39 exo probe RSV B was 19 copies,RSV A was 104 copies molecule 0.96 1

Publication Description

Year of Publication Title Author(s) Journal PMID DOI
2019 Development of a reverse transcription recombinase polymerase amplification assay for rapid detection of human respiratory syncytial virus. Xi, Yun; Xu, Chang-Zhi; Xie, Zhi-Zhi; Zhu, Dong-Lin; Dong, Jie-Ming; Xiao, Gang; MOL CELL PROBE 30922817 10.1016/j.mcp.2019.03.005

Development of a reverse transcription recombinase polymerase amplification assay for rapid detection of human respiratory syncytial virus.

Author(s):

Xi, Yun; Xu, Chang-Zhi; Xie, Zhi-Zhi; Zhu, Dong-Lin; Dong, Jie-Ming; Xiao, Gang;

Journal:

MOL CELL PROBE

Year:

2019

Abstract:

Respiratory syncytial virus (RSV) is one of the most important causative agents that causing respiratory tract infection in children and associated with high morbidity and mortality. A diagnostic method would be a robust tool for identification of RSV infection, especially in the resource-limited settings. Recombinase polymerase amplification (RPA) is a novel isothermal amplification technique which has been widely employed to detect human/animal pathogens. In present study, a probe-based reverse transcription RPA (RT-RPA) assay was established for the detection of RSV. The primers and probe were designed based on the sequences of the conserved nucleocapsid (N) gene. The minimal detection limit of the RT-RPA assay for the detection of RSV B was 19 copies of RNA molecules at 95% probability, whereas the detection limit for RSV A was 104 copies molecule. The assay was RSV-specific since it had no non-specific reactions with other common human pathogens. The clinical performance of the RT-RPA assay was validated using 188 nasopharyngeal aspirates (NPAs). The nucleic acid extraction of the samples was performed by use of the magnetic bead-based kit which didn't require the heavy and expensive centrifuge. The coincidence rates between RT-RPA and qRT-PCR for the clinical samples was 96%, indicating the RT-RPA assay had good diagnostic performance on clinical samples. The real-time RT-RPA assay combined with the manual genome extraction method make it potential to detect clinical samples in field, providing a possible solution for RSV diagnosis in remote rural areas in developing countries.