RPB0123

Pathogen Description

Target Pathogen Pathogen Name NCBI Taxonomy ID Order Family Genus Species Pathogen type
Mycobacterium avium subsp. Paratuberculosis type strain of Mycobacterium avium subsp. paratuberculosis: ATCC:19698, CIP:103963, DSM:44133 1770 Mycobacteriales Mycobacteriaceae Mycobacterium Mycobacterium avium Bacterium

Primer Description

Primer Name Sequence(5'-3') Length(bp) Primer Final Concentration(μM） GC Content（%） Predicted Melting Temperature(℃） Molecular Weight(g/moles) Positions in GenBank accession number
IS900-F2 TCGTCGTTGGCCACCCGCTGCGAGAGCAAT 30 \ 63.3 73.35 9183.99 1111-1146
IS900-R1 Biotin-ACTCGACCGCTAATTGAGAGATGCGATTG 29 \ 48.3 62.19 8941.87 1223-1269
IS900-LF probe 1 FAM-CCACAACCACCTCCGTAACCGTCATTGTC[dSpacer]AGATCAACCCAGCAGAC-C3 Spacer 46 \ 54.3 72.15 13922.1 1223-1269

Gene Description

Target Gene GenBank ID
IS900 X16293.1

Assay Description

Application Assay Primer Designing Software Reaction Time(min) Assay Temperature(℃) Readout System(s) Limit of Detection(LoD) Sensitivity(%) Specificity(%)
detection of Mycobacterium avium subsp. RPA-LFD \ 30 37 LFD assays 8 copies per reaction 0.8824 0.7857

Publication Description

Year of Publication Title Author(s) Journal PMID DOI
2018 Rapid visual detection of Mycobacterium avium subsp. paratuberculosis by recombinase polymerase amplification combined with a lateral flow dipstick Guimin Zhao,Hongmei Wang,Peili Hou,Chengqiang He,Hongbin He Journal of veterinary science 29284204 10.4142/jvs.2018.19.2.242

Rapid visual detection of Mycobacterium avium subsp. paratuberculosis by recombinase polymerase amplification combined with a lateral flow dipstick

Author(s):

Guimin Zhao,Hongmei Wang,Peili Hou,Chengqiang He,Hongbin He

Journal:

Journal of veterinary science

Year:

2018

Abstract:

Paratuberculosis (Johne's disease) is a chronic debilitating disease of domestic and wild ruminants. However, widespread point-of-care testing is infrequent due to the lack of a robust method. The isothermal recombinase polymerase amplification (RPA) technique has applied for rapid diagnosis. Herein, RPA combined with a lateral flow dipstick (LFD) assay was developed to estimate DNA from Mycobacterium avium subsp. paratuberculosis. First, analytical specificity and sensitivity of the RPA-nfo primer and probe sets were assessed. The assay successfully detected M. paratuberculosis DNA in 30 min at 39°C with a detection limit of up to eight copies per reaction, which was equivalent to that of the real-time quantitative polymerase chain reaction (qPCR) assay. The assay was specific, as it did not amplify genomes from five other Mycobacterium spp. or five pathogenic enteric bacteria. Six hundred-twelve clinical samples (320 fecal and 292 serum) were assessed by RPA-LFD, qPCR, and enzyme-linked immunosorbent assay, respectively. The RPA-LFD assay yielded 100% sensitivity, 97.63% specificity, and 98.44% concordance rate with the qPCR results. This is the first report utilizing an RPA-LFD assay to visualize and rapidly detect M. paratuberculosis. Our results show this assay should be a useful method for the diagnosis of paratuberculosis in resource-constrained settings.