RPB0117

Pathogen Description

Target Pathogen Pathogen Name NCBI Taxonomy ID Order Family Genus Species Pathogen type
Mycobacterium Mycobacterium 1763 Corynebacteriales Mycobacteriaceae Mycobacterium 0 Bacterium

Primer Description

Primer Name Sequence(5'-3') Length(bp) Primer Final Concentration(μM) GC Content(%) Predicted Melting Temperature(℃) Molecular Weight(g/moles) Positions in GenBank accession number
RPA-F1 CCAAGCTGCGCCAGGGCAGCTATTTCCCGGAC 32 0.48 65.6 73.84 9771.37 \
RPA-R1 TTGGCCATGATCGACACTTGCGACTTGGA 29 0.48 65.6 73.84 9771.37 \

Gene Description

Target Gene GenBank ID
IS1081 \

Assay Description

Application Assay Primer Designing Software Reaction Time(min) Assay Temperature(℃) Readout System(s) Limit of Detection(LoD) Sensitivity(%) Specificity(%)
Detection of Mycobacterium tuberculosis RPA Primer Premier software version 5.0 120 37 CRISPR/Cas12a system 4.48 fmol/L 0.9929 1

Publication Description

Year of Publication Title Author(s) Journal PMID DOI
2020 An Isothermal Method for Sensitive Detection of Mycobacterium tuberculosis Complex Using Clustered Regularly Interspaced Short Palindromic Repeats/Cas12a Cis and Trans Cleavage Haipo Xu,Xiaolong Zhang,Zhixiong Cai,Xiuqing Dong,Geng Chen,Zhenli Li,Liman Qiu,Lei He,Bin Liang,Xiaolong Liu,Jingfeng Liu The Journal of molecular diagnostics : JMD 32470556 10.1016/j.jmoldx.2020.04.212

An Isothermal Method for Sensitive Detection of Mycobacterium tuberculosis Complex Using Clustered Regularly Interspaced Short Palindromic Repeats/Cas12a Cis and Trans Cleavage

Author(s):

Haipo Xu,Xiaolong Zhang,Zhixiong Cai,Xiuqing Dong,Geng Chen,Zhenli Li,Liman Qiu,Lei He,Bin Liang,Xiaolong Liu,Jingfeng Liu

Journal:

The Journal of molecular diagnostics : JMD

Year:

2020

Abstract:

Tuberculosis is one of the most serious infectious diseases, resulting in death worldwide. Traditional detection methods are not enough to meet the clinical requirements of rapid diagnosis, high specificity, and high sensitivity. Fast, sensitive, and accurate detection of Mycobacterium tuberculosis (MTB) is urgently needed to treat and control tuberculosis disease. Clustered regularly interspaced short palindromic repeats (CRISPR)-associated proteins (Cas12a) exhibit strong nonspecific degradation ability of exogenous single-strand nucleic acids (trans cleavage) after specific recognition of target sequence. We purified Cas12a protein and selected a proper guide RNA based on conserved sequences of MTB from designed guide RNA library. Then, we proposed a novel detection method based on recombinase polymerase amplification and CRISPR/Cas12a nuclease system for specific and sensitive detection of MTB DNA. The assay, based on fluorescence detection, showed 4.48 fmol/L of limit of detection and good linear correlation of concentration with fluorescence value (R2 = 0.9775). It also showed good performance in distinguishing other bacteria. Furthermore, its clinical performance was evaluated by 193 samples and showed sensitivity of 99.29% (139/140) and specificity of 100% (53/53) at 99% CI, compared with culture method. Taken together, the CRISPR/Cas12a system showed good specificity, excellent sensitivity, and excellent accuracy for MTB detection, and it meets requirements of MTB detection in clinical samples and has great potential for clinical translation.