RPB0116

Pathogen Description

Target Pathogen Pathogen Name NCBI Taxonomy ID Order Family Genus Species Pathogen type
Mycobacterium Mycobacterium 1763 Corynebacteriales Mycobacteriaceae Mycobacterium 0 Bacterium

Primer Description

Primer Name Sequence(5'-3') Length(bp) Primer Final Concentration(μM） GC Content（%） Predicted Melting Temperature(℃） Molecular Weight(g/moles) Positions in GenBank accession number
Forward 4 (F4) AACACCCCGGCGTTCGAGTGGTACTACCAGTC 32 \ 59.4 69.98 9770.39 \
Reverse 4 (R4) ACTTGTAAGTCTGGCAGCCAGCCTTACCGCA 31 \ 54.8 68.66 9456.19 \
Probe ACTGTCGATAGTCATGCCGGTCGGCGGGCAG[FAM-dT]CC[THF]GC[BHQ1-dT]TCTACAGCGACTGG[phosphate] 49 \ 65.3 79.67 15115.79 \

Gene Description

Target Gene GenBank ID
Ag85B X62398

Assay Description

Application Assay Primer Designing Software Reaction Time(min) Assay Temperature(℃) Readout System(s) Limit of Detection(LoD) Sensitivity(%) Specificity(%)
etection of Mycobacterium tuberculosis RPA \ 20 39 Exo Probe 4 copies per μl 0.9 0.98

Publication Description

Year of Publication Title Author(s) Journal PMID DOI
2021 Rapid detection of Mycobacterium tuberculosis based on antigen 85B via real-time recombinase polymerase amplification Y Xu,P Wu,H Zhang,J Li Letters in applied microbiology 32726877 10.1111/lam.13364

Rapid detection of Mycobacterium tuberculosis based on antigen 85B via real-time recombinase polymerase amplification

Author(s):

Y Xu,P Wu,H Zhang,J Li

Journal:

Letters in applied microbiology

Year:

2021

Abstract:

Tuberculosis (TB), as a common infectious disease, still remains a severe challenge to public health. Due to the unsatisfied clinical needs of currently available diagnostic vehicles, it is desired to establish a new approach for universally detecting Mycobacterium tuberculosis. Herein, we designed a real-time recombinase polymerase amplification (RPA) technology for identifying M. tuberculosis within 20 min at 39°C via custom-designed oligonucleotide primers and probe, which could specifically target antigen 85B (Ag85B). Particularly, the primers F4-R4 produced the fastest fluorescence signal with the probe among four pairs of designed primers in the RPA assays. The optimal primers/probe combination could effectively identify M. tuberculosis with the detection limit of 4·0 copies per μl, as it could not show a positive signal for the genomic DNA from other mycobacteria or pathogens. The Ag85B-based RPA could determine the genomic DNA extracted from M. tuberculosis with high reliability (100%, 22/22). More importantly, when testing clinical sputum samples, the real-time RPA displayed an admirable sensitivity (90%, 95% CI: 80·0-96·0%) and specificity (98%, 95% CI: 89·0-100·0%) compared to traditional smear microscopy, which was similar to the assay of Xpert MTB/RIF. This real-time RPA based Ag85B provides a promising strategy for the rapid and universal diagnosis of TB.