RPB0115

Pathogen Description

Target Pathogen Pathogen Name NCBI Taxonomy ID Order Family Genus Species Pathogen type
Mycobacterium Mycobacterium 1763 Corynebacteriales Mycobacteriaceae Mycobacterium 0 Bacterium

Primer Description

Primer Name Sequence(5'-3') Length(bp) Primer Final Concentration(μM) GC Content(%) Predicted Melting Temperature(℃) Molecular Weight(g/moles) Positions in GenBank accession number
inhA RPA F2 ACGAGCGTAACCCCAGTGCGAAAGTTCCCG 30 \ 60 69.92 9186.02 1,673,334 1,674,880
inhA RPA R3 GAGCGCGCTGATCCCAGCCCTCCTCGAGCA 30 \ 70 75.4 9113.94 1,673,334 1,674,880

Gene Description

Target Gene GenBank ID
inhA \

Assay Description

Application Assay Primer Designing Software Reaction Time(min) Assay Temperature(℃) Readout System(s) Limit of Detection(LoD) Sensitivity(%) Specificity(%)
Drug Resistance Genotyping Workflow for Mycobacterium tuberculosis RPA \ 90 37 Nanopore sequencing \ 1 1

Publication Description

Year of Publication Title Author(s) Journal PMID DOI
2021 A Rapid Drug Resistance Genotyping Workflow for Mycobacterium tuberculosis, Using Targeted Isothermal Amplification and Nanopore Sequencing Harriet D Gliddon,Dan Frampton,Vanisha Munsamy,Jude Heaney,Thomas Pataillot-Meakin,Eleni Nastouli,Alexander S Pym,Adrie J C Steyn,Deenan Pillay,Rachel A McKendry Microbiology spectrum 34817282 10.1128/Spectrum.00610-21

A Rapid Drug Resistance Genotyping Workflow for Mycobacterium tuberculosis, Using Targeted Isothermal Amplification and Nanopore Sequencing

Author(s):

Harriet D Gliddon,Dan Frampton,Vanisha Munsamy,Jude Heaney,Thomas Pataillot-Meakin,Eleni Nastouli,Alexander S Pym,Adrie J C Steyn,Deenan Pillay,Rachel A McKendry

Journal:

Microbiology spectrum

Year:

2021

Abstract:

Phenotypic drug susceptibility testing (DST) for tuberculosis (TB) requires weeks to yield results. Although molecular tests rapidly detect drug resistance-associated mutations (DRMs), they are not scalable to cover the full genome and the many DRMs that can predict resistance. Whole-genome sequencing (WGS) methods are scalable, but if conducted directly on sputum, typically require a target enrichment step, such as nucleic acid amplification. We developed a targeted isothermal amplification-nanopore sequencing workflow for rapid prediction of drug resistance of TB isolates. We used recombinase polymerase amplification (RPA) to perform targeted isothermal amplification (37°C for 90 min) of three regions within the Mycobacterium tuberculosis genome, followed by nanopore sequencing on the MinION. We tested 29 mycobacterial genomic DNA extracts from patients with drug-resistant (DR) TB and compared our results to those of WGS by Illumina and phenotypic DST to evaluate the accuracy of prediction of resistance to rifampin and isoniazid. Amplification by RPA showed fidelity equivalent to that of high-fidelity PCR (100% concordance). Nanopore sequencing generated DRM predictions identical to those of WGS, with considerably faster sequencing run times of minutes rather than days. The sensitivity and specificity of rifampin resistance prediction for our workflow were 96.3% (95% confidence interval [CI], 81.0 to 99.9%) and 100.0% (95% CI, 15.8 to 100.0%), respectively. For isoniazid resistance prediction, the sensitivity and specificity were 100.0% (95% CI, 86.3 to 100.0%) and 100.0% (95% CI, 39.8 to 100.0%), respectively. The workflow consumable costs per sample are less than £100. Our rapid and low-cost drug resistance genotyping workflow provides accurate prediction of rifampin and isoniazid resistance, making it appropriate for use in resource-limited settings. IMPORTANCE Current methods for diagnosing drug-resistant tuberculosis are time consuming, resulting in delays in patients receiving treatment and in transmission onwards. They also require a high level of laboratory infrastructure, which is often only available at centralized facilities, resulting in further delays to diagnosis and additional barriers to deployment in resource-limited settings. This article describes a new workflow that can diagnose drug-resistant TB in a shorter time, with less equipment, and for a lower price than current methods. The amount of TB DNA is first increased without the need for bulky and costly thermocycling equipment. The DNA is then read using a portable sequencer called a MinION, which indicates whether there are tell-tale changes in the DNA that indicate whether the TB strain is drug resistant. Our workflow could play an important role in the future in the fight against the public health challenge that is TB drug resistance.