RPB0112

Pathogen Description

Target Pathogen Pathogen Name NCBI Taxonomy ID Order Family Genus Species Pathogen type
Mycobacterium Mycobacterium 1763 Corynebacteriales Mycobacteriaceae Mycobacterium 0 Bacterium

Primer Description

Primer Name Sequence(5'-3') Length(bp) Primer Final Concentration(μM） GC Content（%） Predicted Melting Temperature(℃） Molecular Weight(g/moles) Positions in GenBank accession number
rpsl RPA-F2 TCAGTAAGGTCAAGACCGCGGCTCTGAAGGGC 32 0.4 59.4 70.25 9899.47 \
rpsl RPA-R1 CCTGTTTGCGGTTCTTGACACCCTGCGTATCCAGCG 36 0.4 58.3 71.38 10970.13 \

Gene Description

Target Gene GenBank ID
rpsl gene \

Assay Description

Application Assay Primer Designing Software Reaction Time(min) Assay Temperature(℃) Readout System(s) Limit of Detection(LoD) Sensitivity(%) Specificity(%)
Detection of Streptomycin-Resistant Mutations in Mycobacterium tuberculosis RPA \ 30 37 Cas12a RR detection system 0.1% of the target substance 1 1

Publication Description

Year of Publication Title Author(s) Journal PMID DOI
2022 A Recombinase Polymerase Amplification-Coupled Cas12a Mutant-Based Module for Efficient Detection of Streptomycin-Resistant Mutations in Mycobacterium tuberculosis Peng Liu,Xinjie Wang,Juan Liang,Qian Dong,Jinping Zhang,Dongxin Liu,Shuai Wang,Jing Bi,Wenqi Liu,Zhaoqin Wang,Liang Chen,Lei Liu,Xingxu Huang,Guoliang Zhang Frontiers in microbiology 35069497 10.3389/fmicb.2021.796916

A Recombinase Polymerase Amplification-Coupled Cas12a Mutant-Based Module for Efficient Detection of Streptomycin-Resistant Mutations in Mycobacterium tuberculosis

Author(s):

Peng Liu,Xinjie Wang,Juan Liang,Qian Dong,Jinping Zhang,Dongxin Liu,Shuai Wang,Jing Bi,Wenqi Liu,Zhaoqin Wang,Liang Chen,Lei Liu,Xingxu Huang,Guoliang Zhang

Journal:

Frontiers in microbiology

Year:

2022

Abstract:

Drug-resistant tuberculosis (TB) is a serious public health problem and threat to global TB prevention and control. Streptomycin (STR) is the earliest and classical anti-TB drug, and it is the earliest drug that generated resistance to anti-TB treatment, which limits its use in treating TB and impedes TB control efforts. The rapid, economical, and highly sensitive detection of STR-resistant TB may help reduce disease transmission and morbimortality. CRISPR/CRISPR-associated protein (Cas) is a new-generation pathogen detection method that can detect single-nucleotide polymorphisms with high sensitivity and good specificity. In this study, a Cas12a RR detection system that can recognize more non-traditional protospacer-adjacent motif-targeting sequences was developed based on Cas12a combined with recombinase polymerase amplification technology. This system detects 0.1% of the target substance, and the entire detection process can be completed within 60 min. Its sensitivity and specificity for detecting clinical STR-resistant Mycobacterium tuberculosis were both 100%. Overall, the Cas12 RR detection system provides a novel alternative for the rapid, simple, sensitive, and specific detection of STR-resistant TB, which may contribute to the prompt treatment and prevention of disease transmission in STR-resistant TB.