RPB0111

Pathogen Description

Target Pathogen Pathogen Name NCBI Taxonomy ID Order Family Genus Species Pathogen type
Measles morbillivirus Measles morbillivirus, Cell-associated subacute sclerosing panencephalitis, Measles virus, Subacute sclerosing panencephalitis virus, measles virus MV, rougeole virus rubeola virus, subacute sclerose panencephalitis virus, subacute sclerosing panencephalitis virus, SSPEV 11234 Mo\gavirales Paramyxoviridae Morbillivirus Measles morbillivirus Virus

Primer Description

Primer Name Sequence(5'-3') Length(bp) Primer Final Concentration(μM） GC Content（%） Predicted Melting Temperature(℃） Molecular Weight(g/moles) Positions in GenBank accession number
MV-RPA-F AGAATAATGAAGAAGGGGGAGACTATTATGA 31 \ 35.5 55.88 9729.43 \
MV-RPA-R CAGCAGCAGCTGTCCTCTGGAACTGGTCCG 30 \ 63.3 70.45 9183.99 \

Gene Description

Target Gene GenBank ID
\ \

Assay Description

Application Assay Primer Designing Software Reaction Time(min) Assay Temperature(℃) Readout System(s) Limit of Detection(LoD) Sensitivity(%) Specificity(%)
Detection of Measles Virus Two-Stage Isothermal Amplification Method \ 15 39 LAMP 10 copies 0.9412 0.9583

Publication Description

Year of Publication Title Author(s) Journal PMID DOI
2021 Microfluidic Chip with Two-Stage Isothermal Amplification Method for Highly Sensitive Parallel Detection of SARS-CoV-2 and Measles Virus Qin Huang,Xiaohui Shan,Ranran Cao,Xiangyu Jin,Xue Lin,Qiurong He,Yulei Zhu,Rongxin Fu,Wenli Du,Wenqi Lv,Ying Xia,Guoliang Huang Micromachines 34945432 10.3390/mi12121582

Microfluidic Chip with Two-Stage Isothermal Amplification Method for Highly Sensitive Parallel Detection of SARS-CoV-2 and Measles Virus

Author(s):

Qin Huang,Xiaohui Shan,Ranran Cao,Xiangyu Jin,Xue Lin,Qiurong He,Yulei Zhu,Rongxin Fu,Wenli Du,Wenqi Lv,Ying Xia,Guoliang Huang

Journal:

Micromachines

Year:

2021

Abstract:

A two-stage isothermal amplification method, which consists of a first-stage basic recombinase polymerase amplification (RPA) and a second-stage fluorescence loop-mediated isothermal amplification (LAMP), as well as a microfluidic-chip-based portable system, were developed in this study; these enabled parallel detection of multiplex targets in real time in around one hour, with high sensitivity and specificity, without cross-contamination. The consumption of the sample and the reagent was 2.1 μL and 10.6 μL per reaction for RPA and LAMP, respectively. The lowest detection limit (LOD) was about 10 copies. The clinical amplification of about 40 nasopharyngeal swab samples, containing 17 SARS-CoV-2 (severe acute respiratory syndrome coronavirus) and 23 measles viruses (MV), were parallel tested by using the microfluidic chip. Both clinical specificity and sensitivity were 100% for MV, and the clinical specificity and sensitivity were 94.12% and 95.83% for SARS-CoV-2, respectively. This two-stage isothermal amplification method based on the microfluidic chip format offers a convenient, clinically parallel molecular diagnostic method, which can identify different nucleic acid samples simultaneously and in a timely manner, and with a low cost of the reaction reagent. It is especially suitable for resource-limited areas and point-of-care testing (POCT).