RPB0108

Pathogen Description

Target Pathogen Pathogen Name NCBI Taxonomy ID Order Family Genus Species Pathogen type
MERS-CoV Middle East respiratory syndrome-related coronavirus, MERS coronavirus, MERS virus, Middle East Respiratory Syndrome Coronavirus, Middle East respiratory syndrome coronavirus 1335626 Nidovirales Coronaviridae Betacoronavirus Nidovirales Virus

Primer Description

Primer Name Sequence(5'-3') Length(bp) Primer Final Concentration(μM) GC Content(%) Predicted Melting Temperature(℃) Molecular Weight(g/moles) Positions in GenBank accession number
UpE-Fa TTAGCCTAGTTTCTGTAACTGACTTCTCCT 30 0.42 40 58.01 9088.96 27396–27425
UpE-Rb Biotin-GTTCGTTTTCCATATGTCCAAAGAGAGAC 29 0.42 41.4 57.26 8891.85 27588–27560
UpE-Pc FITC-GCGATTCAGTTCCTCTTCACATAATCGCCCCGAGC(THF)CGCTTATCG-C3 Spacer 44 0.12 54.5 71.58 13354.69 27466–27509

Gene Description

Target Gene GenBank ID
UpE JX869059

Assay Description

Application Assay Primer Designing Software Reaction Time(min) Assay Temperature(℃) Readout System(s) Limit of Detection(LoD) Sensitivity(%) Specificity(%)
Detection of Middle East Respiratory Syndrome Coronavirus (MERS-CoV) RT-RPA-VF \ 25 33 FITC 1.2×10¹ copies/μl 1 1

Publication Description

Year of Publication Title Author(s) Journal PMID DOI
2021 Nucleic acid visualization assay for Middle East Respiratory Syndrome Coronavirus (MERS-CoV) by targeting the UpE and N gene. Huang, Pei; Jin, Hongli; Zhao, Yongkun; Li, Entao; Yan, Feihu; Chi, Hang; Wang, Qi; Han, Qiuxue; Mo, Ruo; Song, Yumeng; Bi, Jinhao; Jiao, Cuicui; Li, Wujian; He, Hongbin; Wang, Hongmei; Ma, Aimin; Feng, Na; Wang, Jianzhong; Wang, Tiecheng; Yang, Songtao; Gao, Yuwei; Xia, Xianzhu; Wang, Hualei; PLoS Negl Trop Dis 33647020 10.1371/journal.pntd.0009227

Nucleic acid visualization assay for Middle East Respiratory Syndrome Coronavirus (MERS-CoV) by targeting the UpE and N gene.

Author(s):

Huang, Pei; Jin, Hongli; Zhao, Yongkun; Li, Entao; Yan, Feihu; Chi, Hang; Wang, Qi; Han, Qiuxue; Mo, Ruo; Song, Yumeng; Bi, Jinhao; Jiao, Cuicui; Li, Wujian; He, Hongbin; Wang, Hongmei; Ma, Aimin; Feng, Na; Wang, Jianzhong; Wang, Tiecheng; Yang, Songtao; Gao, Yuwei; Xia, Xianzhu; Wang, Hualei;

Journal:

PLoS Negl Trop Dis

Year:

2021

Abstract:

Since its first emergence in 2012, cases of infection with Middle East respiratory syndrome coronavirus (MERS-CoV) have continued to occur. At the end of January 2020, 2519 laboratory confirmed cases with a case-fatality rate of 34.3% have been reported. Approximately 84% of human cases have been reported in the tropical region of Saudi Arabia. The emergence of MERS-CoV has highlighted need for a rapid and accurate assay to triage patients with a suspected infection in a timely manner because of the lack of an approved vaccine or an effective treatment for MERS-CoV to prevent and control potential outbreaks. In this study, we present two rapid and visual nucleic acid assays that target the MERS-CoV UpE and N genes as a panel that combines reverse transcription recombinase polymerase amplification with a closed vertical flow visualization strip (RT-RPA-VF). This test panel was designed to improve the diagnostic accuracy through dual-target screening after referencing laboratory testing guidance for MERS-CoV. The limit of detection was 1.2脳101 copies/渭l viral RNA for the UpE assay and 1.2 copies/渭l viral RNA for the N assay, with almost consistent with the sensitivity of the RT-qPCR assays. The two assays exhibited no cross-reactivity with multiple CoVs, including the bat severe acute respiratory syndrome related coronavirus (SARSr-CoV), the bat coronavirus HKU4, and the human coronaviruses 229E, OC43, HKU1 and severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2). Furthermore, the panel does not require sophisticated equipment and provides rapid detection within 30 min. This panel displays good sensitivity and specificity and may be useful to rapidly detect MERS-CoV early during an outbreak and for disease surveillance.