RPB0107

Pathogen Description

Target Pathogen Pathogen Name NCBI Taxonomy ID Order Family Genus Species Pathogen type
Legionella pneumophila Legionella pneumophila 446 Legionellales Legionellaceae Legionella Legionella pneumophila Bacterium

Primer Description

Primer Name Sequence(5'-3') Length(bp) Primer Final Concentration(μM) GC Content(%) Predicted Melting Temperature(℃) Molecular Weight(g/moles) Positions in GenBank accession number
nLep-RPA-F2 GCGATTTGGAACCACCTGATACCATCTCGA 30 0.4 50 63.73 9151.01 \
nLep-RPA-R2 5′-Digoxin-CTGGCGATGACCTACTTTCGCATGAGGAAG-3′ 30 0.4 53.3 64.59 9247.06 \
nLep-RPA-P2 5′-FAM-CCTGATACCATCTCGAACTCAGAAGTGAAACATTT[THF]CCGCGCCAATG-C3-Spacer 46 \ 47.8 68.59 14047.19 \

Gene Description

Target Gene GenBank ID
5S rRNA gene NR_075178.1

Assay Description

Application Assay Primer Designing Software Reaction Time(min) Assay Temperature(℃) Readout System(s) Limit of Detection(LoD) Sensitivity(%) Specificity(%)
Detection and Differentiation of Legionella pneumophila and Non-Legionella pneumophila Species EuNPs-LFIC-RPA Primer 8 10 37 LFIC 1.6 × 10¹ CFU/ml, \ \

Publication Description

Year of Publication Title Author(s) Journal PMID DOI
2022 Rapid Detection and Differentiation of Legionella pneumophila and Non -Legionella pneumophila Species by Using Recombinase Polymerase Amplification Combined With EuNPs-Based Lateral Flow Immunochromatography Jungang Du,Biao Ma,Jiali Li,Yaping Wang,Tianyu Dou,Shujuan Xu,Mingzhou Zhang Frontiers in chemistry 35198541 10.3389/fchem.2021.815189

Rapid Detection and Differentiation of Legionella pneumophila and Non -Legionella pneumophila Species by Using Recombinase Polymerase Amplification Combined With EuNPs-Based Lateral Flow Immunochromatography

Author(s):

Jungang Du,Biao Ma,Jiali Li,Yaping Wang,Tianyu Dou,Shujuan Xu,Mingzhou Zhang

Journal:

Frontiers in chemistry

Year:

2022

Abstract:

Legionella, a waterborne pathogen, is the main cause of Legionnaires' disease. Therefore, timely and accurate detection and differentiation of Legionella pneumophila and non-Legionella pneumophila species is crucial. In this study, we develop an easy and rapid recombinase polymerase amplification assay combined with EuNPs-based lateral flow immunochromatography (EuNPs-LFIC-RPA) to specifically distinguish Legionella pneumophila and non-Legionella pneumophila. We designed primers based on the mip gene of Legionella pneumophila and the 5S rRNA gene of non-Legionella pneumophila. The recombinase polymerase amplification reaction could go to completion in 10 min at 37°C, and the amplification products could be detected within 5 min with EuNPs-LFIC strips. Using a florescent test strip reader, the quantitative results were achieved by reading the colored signal intensities on the strips. The sensitivity was 1.6 × 101 CFU/ml, and a linear standard linear curve plotted from the test strip reader had a correlation coefficient for the determination of Legionella pneumophila (R 2 = 0.9516). Completed concordance for the presence or absence of Legionella pneumophila by EuNPs-LFIC-RPA and qPCR was 97.32% (κ = 0.79, 95% CI), according to an analysis of practical water samples (n = 112). In short, this work shows the feasibility of EuNPs-LFIC-RPA for efficient and rapid monitoring of Legionella pneumophila and non-Legionella pneumophila in water samples.