RPB0101

Pathogen Description

Target Pathogen Pathogen Name NCBI Taxonomy ID Order Family Genus Species Pathogen type
Influenza A virus (H7N9) Influenza A virus (H7N9) 333278 Articulavirales Orthomyxoviridae Alphainfluenzavirus Influenza A virus Virus

Primer Description

Primer Name Sequence(5'-3') Length(bp) Primer Final Concentration(μM） GC Content（%） Predicted Melting Temperature(℃） Molecular Weight(g/moles) Positions in GenBank accession number
nfo-H7-F TTCTATGCAGAAATGAAATGGCTCCTGTCAA 31 0.42 38.7 59.53 9518.27 \
nfo-H7-R [Biotin]AGCTGGGCTTTTTCTTGTATTTTTATATGACTTAG 35 0.42 31.4 56.17 10754.03 \
nfo-H7-P [FAM]AAATGAAATGGCTCCTGTCAAACACAGATA[THF]TGCTGCATTCCCGCA[C3-spacer] 45 0.12 44.4 68.61 13782.03 \

Gene Description

Target Gene GenBank ID
HA gene \

Assay Description

Application Assay Primer Designing Software Reaction Time(min) Assay Temperature(℃) Readout System(s) Limit of Detection(LoD) Sensitivity(%) Specificity(%)
Detection of Avian Influenza A Virus (H7N9) LFD-RPA rimer 5.0 20 39 LFD 32 fg, 4×10³ copies 1 1

Publication Description

Year of Publication Title Author(s) Journal PMID DOI
2018 Rapid Detection of Avian Influenza A Virus (H7N9) by Lateral Flow Dipstick Recombinase Polymerase Amplification Shiwei Ma,Xue Li,Bo Peng,Weihua Wu,Xin Wang,Hui Liu,Lihong Yuan,Shisong Fang,Jiahai Lu Biological & pharmaceutical bulletin 30232304 10.1248/bpb.b18-00468

Rapid Detection of Avian Influenza A Virus (H7N9) by Lateral Flow Dipstick Recombinase Polymerase Amplification

Author(s):

Shiwei Ma,Xue Li,Bo Peng,Weihua Wu,Xin Wang,Hui Liu,Lihong Yuan,Shisong Fang,Jiahai Lu

Journal:

Biological & pharmaceutical bulletin

Year:

2018

Abstract:

Avian influenza A (H7N9) virus has caused several epidemics and infection in both human and poultry. With mutation, the H7N9 virus gained its fifth endemic in China. Early diagnosis is crucial for the control of viral spread in poultry and prognosis of infected patients. In this study, we developed and evaluated a lateral flow dipstick recombinase polymerase amplification (LFD-RPA) assay for rapid detection of both hemagglutinin and neuraminidase gene of H7N9. Our H7-LFD-RPA and N9-LFD-RPA assay were able to detect 32 fg H7N9 nucleic acid which is more convenient and rapid than previous methods. Through detecting 50 influenza positive samples, cross-reaction was not found with other subtypes of influenza virus. The 100% analytical specificity and sufficient analytical sensitivity results agreed the real time RT-PCR assay. The results data demonstrated that our method performed well and could be applied to the detection of H7N9 virus. This LFD-RPA assay provides a candidate method for rapid point-of-care diagnosis of H7N9.