RPB0100

Pathogen Description

Target Pathogen Pathogen Name NCBI Taxonomy ID Order Family Genus Species Pathogen type
Influenza A virus Influenza A virus, FLUAV, Human Influenza A Virus, Influenza virus type A 11320 Articulavirales Orthomyxoviridae Alphainfluenzavirus Influenza A virus Virus

Primer Description

Primer Name Sequence(5'-3') Length(bp) Primer Final Concentration(μM) GC Content(%) Predicted Melting Temperature(℃) Molecular Weight(g/moles) Positions in GenBank accession number
H3F763 Biotin-GAATAAGCATCTATTGGACAATAGTAAAAC 30 0.4 30 51.4 9255.13 \
H3R1156 CCCTCAGAATTTTGATGCCTGAAACCGTACCA 32 0.2 46.9 63.66 9728.39 \
H3-P FITC-ATGGGTGCATCTGATCTCATTATTGAGCTTT-THF-CCCACTTCGTATTTTG-spacer(C3) 47 0.12 39.4 65.41 14988.76 \

Gene Description

Target Gene GenBank ID
H3 \

Assay Description

Application Assay Primer Designing Software Reaction Time(min) Assay Temperature(℃) Readout System(s) Limit of Detection(LoD) Sensitivity(%) Specificity(%)
detection of influenza A virus and subtyping of H1 and H3 RT-RPA-LFD \ 20 39 LFDs 112.2 copies 0.71 1

Publication Description

Year of Publication Title Author(s) Journal PMID DOI
2018 Reverse transcription recombinase polymerase amplification with lateral flow dipsticks for detection of influenza A virus and subtyping of H1 and H3 Ning Sun,Weiping Wang,Jie Wang,Xinyue Yao,Fangfang Chen,Xiaojun Li,Yi Yinglei,Bo Chen Molecular and cellular probes 30394299 10.1016/j.mcp.2018.10.004

Reverse transcription recombinase polymerase amplification with lateral flow dipsticks for detection of influenza A virus and subtyping of H1 and H3

Author(s):

Ning Sun,Weiping Wang,Jie Wang,Xinyue Yao,Fangfang Chen,Xiaojun Li,Yi Yinglei,Bo Chen

Journal:

Molecular and cellular probes

Year:

2018

Abstract:

Three reverse transcription recombinase polymerase amplification assays with lateral flow dipsticks (RT-RPA-LFD) were developed for identification of the matrix and hemagglutinin (HA) genes to detect influenza A virus and distinguish subtypes H1 and H3. Assessment of the assays' specificity showed that there was no cross-reactivity with other targets. Their limits of detection were 123.6 copies per reaction for the matrix gene, 677.1 copies per reaction for the H1 HA gene, and 112.2 copies/reaction for the H3 HA gene. Of 111 samples tested by RT-RPA-LFD assays, 27 were positive for influenza A virus, 14 were positive for H1, and 10 were positive for H3. Compared to the results obtained from real-time RT-PCR assays, the sensitivity of RT-RPA-LFD assays was 75%, 93.33% and 71.43% for the matrix, H1, and H3, with 100% specificity. The sensitivity of RT-RPA-LFD assays is lower than that of real-time RT-PCR, comparable or better than that of conventional RT-PCR, and much better than that of RIDTs. In conclusion, these assays offer an efficient and reliable tool for identification and subtyping of influenza A virus (subtype H1 and H3) in the resource-limited setting.