Target Pathogen | Pathogen Name | NCBI Taxonomy ID | Order | Family | Genus | Species | Pathogen type |
---|---|---|---|---|---|---|---|
EV-A71 | Enterovirus 71, Enterovirus EV-A71, Human enterovirus 71, Human enterovirus A71, Human enterovirus type 71, enterovirus type 71 | 39054 | Picornavirales | Picornaviridae | Enterovirus | Enterovirus A | Virus |
Primer Name | Sequence(5'-3') | Length(bp) | Primer Final Concentration(μM) | GC Content(%) | Predicted Melting Temperature(℃) | Molecular Weight(g/moles) | Positions in GenBank accession number |
---|---|---|---|---|---|---|---|
EV71-F1 | TGCCATTCATGTCACCTGCGAGTGCTTATC | 30 | 0.42 | 50 | 64.38 | 9123.97 | \ |
EV71-R1 | CCTGACGTGCTTCATTCTCATGTAAATCCTAA | 32 | 0.42 | 40.6 | 59.51 | 9709.38 | \ |
EV71-TPR1 | CCCACAGTCCGCACTGAGAACGTGCCCA-[FAM-dT]-C-[THF][BHQ1-dT]-GTTATTAGGACATGC-[C3-spacer] | 44 | 0.12 | 56.8 | 73.09 | 13446.77 | \ |
Application | Assay | Primer Designing Software | Reaction Time(min) | Assay Temperature(℃) | Readout System(s) | Limit of Detection(LoD) | Sensitivity(%) | Specificity(%) |
---|---|---|---|---|---|---|---|---|
detection of human enterovirus 71 | RT-RPA | BLAST tools of the NCBI | 20 | 40 | exo probe | 3.767 log10 genomic copies (LGC)/reaction | 0.895 | 1 |
Year of Publication | Title | Author(s) | Journal | PMID | DOI | ||
---|---|---|---|---|---|---|---|
2018 | Development and evaluation of a rapid recombinase polymerase amplification assay for the detection of human enterovirus 71 | Dan Yin,Yanan Zhu,Kaifeng Wang,Jing Wang,Xiru Zhang,Min Han,Yaqing He,Qing Chen,Guifang Hu | Archives of virology | 29767300 | 10.1007/s00705-018-3859-x | ||
Development and evaluation of a rapid recombinase polymerase amplification assay for the detection of human enterovirus 71Author(s):Dan Yin,Yanan Zhu,Kaifeng Wang,Jing Wang,Xiru Zhang,Min Han,Yaqing He,Qing Chen,Guifang HuJournal:Archives of virologyYear:2018Abstract:Enterovirus 71 (EV71) is one of the most common pathogens of hand, foot, and mouth disease (HFMD). A rapid reverse transcription recombinase polymerase amplification (RT-RPA) assay was established to detect EV71 subgenotype C4 (EV71-C4). The 95% detection limit of the RT-RPA was 3.767 log10 genomic copies (LGC)/reaction. The specificity was 100%. In a clinical sample evaluation, this approach demonstrated sufficient clinical performance when compared with a commercial RT-qPCR diagnostic kit. Thus, the RT-RPA assay may be a promising alternative for the detection of EV71-C4.PMID:29767300
|