RPB0084

Pathogen Description

Target Pathogen Pathogen Name NCBI Taxonomy ID Order Family Genus Species Pathogen type
Aspergillus fumigatus Aspergillus fumigatus, Sartorya fumigata, Neosartorya fumigata 746128 Eurotiales Aspergillaceae Aspergillus Aspergillus fumigatus Fungus

Primer Description

Primer Name Sequence(5'-3') Length(bp) Primer Final Concentration(μM） GC Content（%） Predicted Melting Temperature(℃） Molecular Weight(g/moles) Positions in GenBank accession number
forward primer TAATACGACTCACTATAGGGGGTCCAACCTCCCACCCGTGTCTATC 46 \ 52.2 70.24 13990.12 \
reverse primer TCGATGATTCACTGAATTCTGCAATTCACATTAC 34 \ 35.3 58.16 10350.81 \

Gene Description

Target Gene GenBank ID
\ \

Assay Description

Application Assay Primer Designing Software Reaction Time(min) Assay Temperature(℃) Readout System(s) Limit of Detection(LoD) Sensitivity(%) Specificity(%)
test for pulmonary Aspergillus fumigatus infection CRISPR-derived RNA (crRNA) and the corresponding recombinase polymerase amplification (RPA) primer sequence with the T7 promoter for the CRISPR assay. \ 30 37 CRISPR/Cas13a system 3 copies in a single reaction system 1 0.917

Publication Description

Year of Publication Title Author(s) Journal PMID DOI
2022 Development and clinical implications of a novel CRISPR-based diagnostic test for pulmonary Aspergillus fumigatus infection Zhengtu Li,Mingdie Wang,Teng Xu,Yangqing Zhan,Fengyi Chen,Ye Lin,Shaoqiang Li,Jing Cheng,Feng Ye Journal of microbiology, immunology, and infection = Wei mian yu gan ran za zhi 34969623 10.1016/j.jmii.2021.11.008

Development and clinical implications of a novel CRISPR-based diagnostic test for pulmonary Aspergillus fumigatus infection

Author(s):

Zhengtu Li,Mingdie Wang,Teng Xu,Yangqing Zhan,Fengyi Chen,Ye Lin,Shaoqiang Li,Jing Cheng,Feng Ye

Journal:

Journal of microbiology, immunology, and infection = Wei mian yu gan ran za zhi

Year:

2022

Abstract:

Background: Rapid and reliable diagnostic methods for Aspergillus fumigatus infection are urgently needed. Clustered regularly interspaced short palindromic repeat (CRISPR)-associated protein 13a (Cas13a) has high sensitivity and specificity in the diagnosis of viral infection. However, its potential use in detecting A. fumigatus remains unexplored. A highly sensitive and specific method using the CRISPR/Cas13a system was developed for the reliable and rapid detection of A. fumigatus. Methods: The conserved internal transcribed spacer (ITS) region of A. fumigatus was used to design CRISPR-derived RNA (crRNA) and the corresponding recombinase polymerase amplification (RPA) primer sequence with the T7 promoter for the CRISPR assay. Twenty-five clinical isolates and 43 bronchoalveolar lavage fluid (BALF) remaining from routine examinations of patients with confirmed pulmonary aspergillosis were collected to further validate the CRISPR assay. Results: No amplification signal was observed when genomic DNA from closely clinically related Aspergillus species, such as Aspergillus flavus, Aspergillus niger, and Aspergillus terreus, as well as Monascus purpureus Went and Escherichia coli, was tested by this assay, and the detection limit for A. fumigatus was 3 copies in a single reaction system. Validation experiments using the 25 clinical isolates demonstrated 91.7% specificity for the A. fumigatus section, and the sensitivity was 100% when first-generation sequencing was used as the standard. There was no significant difference between the PCR and CRISPR methods (P = 1.0), and the diagnosis results of the two methods were consistent (Kappa = 0.459, P = 0.003). Conclusion: The study offers a new validated CRISPR/Cas13a technique for A. fumigatus detection, providing a simple, rapid and affordable test that is ready for application in the diagnosis of A. fumigatus infection.