RPB0080

Pathogen Description

Target Pathogen Pathogen Name NCBI Taxonomy ID Order Family Genus Species Pathogen type
Acinetobacter baumannii Acinetobacter baumannii, Acinetobacter genomosp. 2, Bacterium anitratum 470 Moraxellales Moraxellaceae Acinetobacter Acinetobacter baumannii Bacterium

Primer Description

Primer Name Sequence(5'-3') Length(bp) Primer Final Concentration(μM） GC Content（%） Predicted Melting Temperature(℃） Molecular Weight(g/moles) Positions in GenBank accession number
blaOXA-51-F3 GTTATCCAACAAGGCCAAACTCAACAAAGCT 31 0.42 41.9 61.03 9450.25 2228035-2228065
blaOXA-51-R2B Biotin-AAATACTTCTGTGGTGGTTGCCTTATGGTGC 31 0.42 45.2 62.4 9563.25 2228148-2228178
blaOXA-51-P FITC-AGCTATGGTAATGATCTTGCTCGTGCTTCGA[THF]CGAGGATGTAGCTGCT-C3 Spacer 47 0.12 48.9 70.32 14531.45 \

Gene Description

Target Gene GenBank ID
bla OXA-51 CP043953.1

Assay Description

Application Assay Primer Designing Software Reaction Time(min) Assay Temperature(℃) Readout System(s) Limit of Detection(LoD) Sensitivity(%) Specificity(%)
Detection of Carbapenem-Resistant Acinetobacter baumannii RPA Primer-Basic Local Alignment Search Tool (BLAST) (https://www.ncbi.nlm.nih.gov/tools/primer-blast/) 30 37 lateral flow strip (LFS) 10⁰ CFU/reaction \ \

Publication Description

Year of Publication Title Author(s) Journal PMID DOI
2022 Development and Clinical Application of a Recombinase Polymerase Amplification-Lateral Flow Strip Assay for Detection of Carbapenem-Resistant Acinetobacter baumannii Lei Wang,Dunpo Sun,Li Chen,Ping Zhou,Kun Wang,Fang Wang,Xingqi Lei,Yan Wang,Yingzhi Lu,Guanhong Huang,Xuzhu Gao Frontiers in cellular and infection microbiology 35646723 10.3389/fcimb.2022.876552

Development and Clinical Application of a Recombinase Polymerase Amplification-Lateral Flow Strip Assay for Detection of Carbapenem-Resistant Acinetobacter baumannii

Author(s):

Lei Wang,Dunpo Sun,Li Chen,Ping Zhou,Kun Wang,Fang Wang,Xingqi Lei,Yan Wang,Yingzhi Lu,Guanhong Huang,Xuzhu Gao

Journal:

Frontiers in cellular and infection microbiology

Year:

2022

Abstract:

Acinetobacter baumannii is a worldwide, primary cause of respiratory tract infections, septicemia, urinary apparatus infections, and secondary meningitis. It can be fatal. Rapid and accurate detection methods are needed to control the spread of carbapenem-resistant A. baumannii (CRAB). Current molecular diagnostic methods are limited and not suitable for on-site detection. In this study, an isothermal detection method using recombinase polymerase amplification (RPA) combined with a lateral flow strip (LFS) was developed to target the blaOXA-51 and blaOXA-23 genes of A. baumannii. The reaction was completed in about 40 min at 37°C. This method can also effectively distinguish A. baumannii and CRAB. The limit of detection of 100-101 CFU/reaction was equal to that of other detection methods. The detection accuracy was equal to that of the qPCR method with the use of clinical samples. The RPA-LFS assay is portable, rapid, and accurate and could replace existing detection methods for on-site detection of A. baumannii and CRAB.