RPB0076

Pathogen Description

Target Pathogen Pathogen Name NCBI Taxonomy ID Order Family Genus Species Pathogen type
SARS-CoV-2 SARS-CoV-2, 2019-nCoV, COVID-19, COVID-19 virus, SARS2, Wuhan coronavirus, Human coronavirus 2019, COVID19, HCoV-19, SARS-2, SARS-CoV4 2697049 Nidovirales Coronaviridae Betacoronavirus Severe acute respiratory syndrome-related coronavirus virus

Primer Description

Primer Name Sequence(5'-3') Length(bp) Primer Final Concentration(μM） GC Content（%） Predicted Melting Temperature(℃） Molecular Weight(g/moles) Positions in GenBank accession number
Fwd primer T*T*T*T*T*T*TAACATCACTAGGTTTCAAACTTTACTTGC 36 \ 33.3 54.69  9115.01 \
Rev primer CCAACCTGAAGAAGAATCACCAGGAGTCAA 30 \ 46.7 61.76 9211.08 \
LFD probe T*T*T*T*T*T*T/iFluorT/TTTTTTTTTTTTTAGGAGTCAAATAACTT/3ddC/ 36 \ 29.4 38.86  5217.49 \

Gene Description

Target Gene GenBank ID
\ \

Assay Description

Application Assay Primer Designing Software Reaction Time(min) Assay Temperature(℃) Readout System(s) Limit of Detection(LoD) Sensitivity(%) Specificity(%)
\ \ \ 5 42 LFD 4copies/50ul 100 100

Publication Description

Year of Publication Title Author(s) Journal PMID DOI
2020 Single-strand RPA for rapid and sensitive detection of SARS-CoV-2 RNA. Kim, Youngeun; Yaseen, Adam B; Kishi, Jocelyn Y; Hong, Fan; Saka, Sinem K; Sheng, Kuanwei; Gopalkrishnan, Nikhil; Schaus, Thomas E; Yin, Peng; medRxiv. 32839783 10.1101/2020.08.17.20177006

Single-strand RPA for rapid and sensitive detection of SARS-CoV-2 RNA.

Author(s):

Kim, Youngeun; Yaseen, Adam B; Kishi, Jocelyn Y; Hong, Fan; Saka, Sinem K; Sheng, Kuanwei; Gopalkrishnan, Nikhil; Schaus, Thomas E; Yin, Peng;

Journal:

medRxiv.

Year:

2020

Abstract:

We report the single-strand Recombinase Polymerase Amplification (ssRPA) method, which merges the fast, isothermal amplification of RPA with subsequent rapid conversion of the double-strand DNA amplicon to single strands, and hence enables facile hybridization-based, high-specificity readout. We demonstrate the utility of ssRPA for sensitive and rapid (4 copies per 50 渭L reaction within 10 min, or 8 copies within 8 min) visual detection of SARS-CoV-2 RNA spiked samples, as well as clinical saliva and nasopharyngeal swabs in VTM or water, on lateral flow devices. The ssRPA method promises rapid, sensitive, and accessible RNA detection to facilitate mass testing in the COVID-19 pandemic.