RPB0075

Pathogen Description

Target Pathogen Pathogen Name NCBI Taxonomy ID Order Family Genus Species Pathogen type
SARS-CoV-2 SARS-CoV-2, 2019-nCoV, COVID-19, COVID-19 virus, SARS2, Wuhan coronavirus, Human coronavirus 2019, COVID19, HCoV-19, SARS-2, SARS-CoV4 2697049 Nidovirales Coronaviridae Betacoronavirus Severe acute respiratory syndrome-related coronavirus virus

Primer Description

Primer Name Sequence(5'-3') Length(bp) Primer Final Concentration(μM） GC Content（%） Predicted Melting Temperature(℃） Molecular Weight(g/moles) Positions in GenBank accession number
N gene F1 CAACTTCCTCAAGGAACAACATTGCCAAAA 30 \ 40 59.58 9121.04 \
N gene F2 GGCTTCTACGCAGAAGGGAGCAGAGGCGGCAG 32 \ 65.6 73.04 9989.52 \
N gene F3 CAACTGGCAGTAACCAGAATGGAGAACGCA 30 \ 50 64.31 9267.11 \
N gene F4 TCGAGGACAAGGCGTTCCAATTAACACCAA 30 \ 46.7 63.51 9193.06 \
N gene F5 CCTAGGAACTGGGCCAGAAGCTGGACTTCC 30 \ 60 68.13 9217.03 \
N gene F6 AACTTCTCCTGCTAGAATGGCTGGCAATGG 30 \ 50 64.29 9222.04 \
N gene F7 ATGAAACTCAAGCCTTACCGCAGAGACAGA 30 \ 46.7 62.87 9202.07 \
N gene F8 CAATCCTGCTAACAATGCTGCAATCGTGCTA 31 \ 45.2 62.59 9439.2 \
N gene F9 CACCAAAAGATCACATTGGCACCCGCAATCC 31 \ 51.6 65.72 9387.18 \
N gene F10 CTGAGGGAGCCTTGAATACACCAAAAGTCACA 32 \ 46.9 63.3 9835.48 \
N gene R1 TGGAGTTGAATTTCTTGAACTGTTGCGACT 30 \ 40 59.96 9258.07 \
N gene R2 CTTCCTTGCCTGTTGAGTGAGAGCGGTGA 29 \ 55.2 66.19 8955.84 \
N gene R3 CTTGGACTGAGATCTTTCATTTTACCGTCA 30 \ 40 58 9137.99 \
N gene R4 GCAGGATTGCGGGTGCCAATGTGATCTTTT 30 \ 50 65.37 9284.07 \
N gene R5 TGGCCTGTTGTTGTTGGCCTTTACCAGAC 29 \ 51.7 65.16 8881.8 \
N gene R6 TTGAGTCAGCACTGCTCATGGATTGTTGCA 30 \ 46.7 63.91 9228.04 \

Gene Description

Target Gene GenBank ID
N gene \

Assay Description

Application Assay Primer Designing Software Reaction Time(min) Assay Temperature(℃) Readout System(s) Limit of Detection(LoD) Sensitivity(%) Specificity(%)
\ \ \ 35 37 LFA 5 copies/ul 100 100

Publication Description

Year of Publication Title Author(s) Journal PMID DOI
2020 An enhanced isothermal amplification assay for viral detection. Qian, Jason; Boswell, Sarah A; Chidley, Christopher; Lu, Zhi-Xiang; Pettit, Mary E; Gaudio, Benjamin L; Fajnzylber, Jesse M; Ingram, Ryan T; Ward, Rebecca H; Li, Jonathan Z; Springer, Michael; Nat Commun 33219228 10.1038/s41467-020-19258-y

An enhanced isothermal amplification assay for viral detection.

Author(s):

Qian, Jason; Boswell, Sarah A; Chidley, Christopher; Lu, Zhi-Xiang; Pettit, Mary E; Gaudio, Benjamin L; Fajnzylber, Jesse M; Ingram, Ryan T; Ward, Rebecca H; Li, Jonathan Z; Springer, Michael;

Journal:

Nat Commun

Year:

2020

Abstract:

Rapid, inexpensive, robust diagnostics are essential to control the spread of infectious diseases. Current state of the art diagnostics are highly sensitive and specific, but slow, and require expensive equipment. Here we report the development of a molecular diagnostic test for SARS-CoV-2 based on an enhanced recombinase polymerase amplification (eRPA) reaction. eRPA has a detection limit on patient samples down to 5 viral copies, requires minimal instrumentation, and is highly scalable and inexpensive. eRPA does not cross-react with other common coronaviruses, does not require RNA purification, and takes ~45鈥塵in from sample collection to results. eRPA represents a first step toward at-home SARS-CoV-2 detection and can be adapted to future viruses within days of genomic sequence availability.