RPB0070

Pathogen Description

Target Pathogen Pathogen Name NCBI Taxonomy ID Order Family Genus Species Pathogen type
SARS-CoV-2 SARS-CoV-2, 2019-nCoV, COVID-19, COVID-19 virus, SARS2, Wuhan coronavirus, Human coronavirus 2019, COVID19, HCoV-19, SARS-2, SARS-CoV4 2697049 Nidovirales Coronaviridae Betacoronavirus Severe acute respiratory syndrome-related coronavirus virus

Primer Description

Primer Name Sequence(5'-3') Length(bp) Primer Final Concentration(μM) GC Content(%) Predicted Melting Temperature(℃) Molecular Weight(g/moles) Positions in GenBank accession number
CV125-F CTGATTACAAACATTGGCCGCAAATT 26 \ 38.5 56.39 7938.25 \
CV434-R CGACTTATTCGTATAACTGCG 21 \ 42.9 50.48 6396.23 \

Gene Description

Target Gene GenBank ID
N gene \

Assay Description

Application Assay Primer Designing Software Reaction Time(min) Assay Temperature(℃) Readout System(s) Limit of Detection(LoD) Sensitivity(%) Specificity(%)
\ \ \ 30 42 CRISPR/Cas2a 40 copies/ul 93.75 100

Publication Description

Year of Publication Title Author(s) Journal PMID DOI
2022 iSCAN-V2: A One-Pot RT-RPA-CRISPR/Cas12b Assay for Point-of-Care SARS-CoV-2 Detection. Aman, Rashid; Marsic, Tin; Sivakrishna Rao, Gundra; Mahas, Ahmed; Ali, Zahir; Alsanea, Madain; Al-Qahtani, Ahmed; Alhamlan, Fatimah; Mahfouz, Magdy; Front Bioeng Biotechnol 35127671 10.3389/fbioe.2021.800104

iSCAN-V2: A One-Pot RT-RPA-CRISPR/Cas12b Assay for Point-of-Care SARS-CoV-2 Detection.

Author(s):

Aman, Rashid; Marsic, Tin; Sivakrishna Rao, Gundra; Mahas, Ahmed; Ali, Zahir; Alsanea, Madain; Al-Qahtani, Ahmed; Alhamlan, Fatimah; Mahfouz, Magdy;

Journal:

Front Bioeng Biotechnol

Year:

2022

Abstract:

Rapid, specific, and sensitive detection platforms are prerequisites for early pathogen detection to efficiently contain and control the spread of contagious diseases. Robust and portable point-of-care (POC) methods are indispensable for mass screening of SARS-CoV-2. Clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated protein (Cas)-based nucleic acid detection technologies coupled with isothermal amplification methods provide a straightforward and easy-to-handle platform for detecting SARS-CoV-2 at POC, low-resource settings. Recently, we developed iSCAN, a two-pot system based on coupled loop-mediated isothermal amplification (LAMP) and CRISPR/Cas12a reactions. However, in two-pot systems, the tubes must be opened to conduct both reactions; two-pot systems thus have higher inherent risks of cross-contamination and a more cumbersome workflow. In this study, we developed and optimized iSCAN-V2, a one-pot reverse transcription-recombinase polymerase amplification (RT-RPA)-coupled CRISPR/Cas12b-based assay for SARS-CoV-2 detection, at a single temperature in less than an hour. Compared to Cas12a, Cas12b worked more efficiently in the iSCAN-V2 detection platform. We assessed and determined the critical factors, and present detailed guidelines and considerations for developing and establishing a one-pot assay. Clinical validation of our iSCAN-V2 detection module with reverse transcription-quantitative PCR (RT-qPCR) on patient samples showed 93.75% sensitivity and 100% specificity. Furthermore, we coupled our assay with a low-cost, commercially available fluorescence visualizer to enable its in-field deployment and use for SARS-CoV-2 detection. Taken together, our optimized iSCAN-V2 detection platform displays critical features of a POC molecular diagnostic device to enable mass-scale screening of SARS-CoV-2 in low-resource settings.