RPB0067

Pathogen Description

Target Pathogen Pathogen Name NCBI Taxonomy ID Order Family Genus Species Pathogen type
SARS-CoV-2 SARS-CoV-2, 2019-nCoV, COVID-19, COVID-19 virus, SARS2, Wuhan coronavirus, Human coronavirus 2019, COVID19, HCoV-19, SARS-2, SARS-CoV4 2697049 Nidovirales Coronaviridae Betacoronavirus Severe acute respiratory syndrome-related coronavirus virus

Primer Description

Primer Name Sequence(5'-3') Length(bp) Primer Final Concentration(μM) GC Content(%) Predicted Melting Temperature(℃) Molecular Weight(g/moles) Positions in GenBank accession number
SARS-COV-2-N-F GGGGAACTTCTCCTGCTAGAATGGCTGGCAATGGCGGTG 39 \ 59 72.98 12119.88 \
SARS-COV-2-N-R CAGCTTGAGAGCAAAATGTCT 21 \ 42.9 52.81 6454.28 \

Gene Description

Target Gene GenBank ID
N gene \

Assay Description

Application Assay Primer Designing Software Reaction Time(min) Assay Temperature(℃) Readout System(s) Limit of Detection(LoD) Sensitivity(%) Specificity(%)
\ \ \ 20 37 CRISPR/Cas2a 1 copies/ul 100 100

Publication Description

Year of Publication Title Author(s) Journal PMID DOI
2021 Reverse Transcription Recombinase Polymerase Amplification Coupled with CRISPR-Cas12a for Facile and Highly Sensitive Colorimetric SARS-CoV-2 Detection. Zhang, Wei S; Pan, Jianbin; Li, Feng; Zhu, Min; Xu, Mengting; Zhu, Hongyan; Yu, Yanyan; Su, Gaoxing; ANAL CHEM 33570401 10.1021/acs.analchem.1c00013

Reverse Transcription Recombinase Polymerase Amplification Coupled with CRISPR-Cas12a for Facile and Highly Sensitive Colorimetric SARS-CoV-2 Detection.

Author(s):

Zhang, Wei S; Pan, Jianbin; Li, Feng; Zhu, Min; Xu, Mengting; Zhu, Hongyan; Yu, Yanyan; Su, Gaoxing;

Journal:

ANAL CHEM

Year:

2021

Abstract:

The outbreak of the pandemic caused by the severe acute respiratory syndrome coronavirus-2 (SARS-CoV-2) calls for an urgent unmet need for developing a facial and cost-effective detection method. The requirement of well-trained personnel and sophisticated instrument of current primary mean (reverse transcription polymerase chain reaction, RT-PCR) may hinder the practical application worldwide. In this regard, a reverse transcription recombinase polymerase amplification (RT-RPA) coupled with CRISPR-Cas12a colorimetric assay is proposed for the SARS-CoV-2 detection. The methodology we have described herein utilizes DNA-modified gold nanoparticles (AuNPs) as a universal colorimetric readout and can specifically target ORF1ab and N regions of the SARS-CoV-2 genome. After the virus genome is amplified through RT-RPA, the resulting abundant dsDNA will bind and activate Cas12a. Under trans-cleavage degradation, the capped DNA substrate will be hydrolyzed gradually from AuNPs, demonstrating a change in the surface plasmon resonance (SPR), which can be facially monitored by UV-vis absorbance spectroscopy and naked eye observation. The high amplification efficiency from RT-RPA and Cas12a trans-cleavage process bring the sensitivity of our method to 1 copy of viral genome sequence per test. Notably, under the dual variations inspecting from the isothermal amplification and Cas12a activation process, the false positive events from other beta coronavirus members can be effectively avoided and thus significantly improve the specificity. Furthermore, the reliability of this colorimetric assay is validated by standard clinical samples from the hospital laboratory department. Through integration of the inherently high sensitivity and specificity from an RPA-coupled Cas12a system with the intrinsic simplicity of AuNP-based colorimetric assay, our method increases the practical testing availability of SARS-CoV-2.