RPB0059

Pathogen Description

Target Pathogen Pathogen Name NCBI Taxonomy ID Order Family Genus Species Pathogen type
SARS-CoV-2 SARS-CoV-2, 2019-nCoV, COVID-19, COVID-19 virus, SARS2, Wuhan coronavirus, Human coronavirus 2019, COVID19, HCoV-19, SARS-2, SARS-CoV4 2697049 Nidovirales Coronaviridae Betacoronavirus Severe acute respiratory syndrome-related coronavirus virus

Primer Description

Primer Name Sequence(5'-3') Length(bp) Primer Final Concentration(μM） GC Content（%） Predicted Melting Temperature(℃） Molecular Weight(g/moles) Positions in GenBank accession number
E gene-RT-RPA primer-F Biotin-CGGAAGAGACAGGTACGTTAATAGTTAATAGC 30 \ 53.3 65.31 9318.09 \
E gene-RT-RPA primer-R AGACCAGAAGATCAGGAACTCTAGAAGAAT 30 \ 53.3 66.03 9179.99 \

Gene Description

Target Gene GenBank ID
E gene \

Assay Description

Application Assay Primer Designing Software Reaction Time(min) Assay Temperature(℃) Readout System(s) Limit of Detection(LoD) Sensitivity(%) Specificity(%)
\ \ \ 60 37 CRISPR/Cas9 100 copies per reaction 100 100

Publication Description

Year of Publication Title Author(s) Journal PMID DOI
2020 Simultaneous Dual-Gene Diagnosis of SARS-CoV-2 Based on CRISPR/Cas9-Mediated Lateral Flow Assay Xiong, Erhu; Jiang, Ling; Tian, Tian; Hu, Menglu; Yue, Huahua; Huang, Mengqi; Lin, Wei; Jiang, Yongzhong; Zhu, Debin; Zhou, Xiaoming; ANGEW CHEM INT EDIT 33295064 10.1002/anie.202014506

Simultaneous Dual-Gene Diagnosis of SARS-CoV-2 Based on CRISPR/Cas9-Mediated Lateral Flow Assay

Author(s):

Xiong, Erhu; Jiang, Ling; Tian, Tian; Hu, Menglu; Yue, Huahua; Huang, Mengqi; Lin, Wei; Jiang, Yongzhong; Zhu, Debin; Zhou, Xiaoming;

Journal:

ANGEW CHEM INT EDIT

Year:

2020

Abstract:

Few methods for the detection of SARS-CoV-2 currently have the capability to simultaneously detect two genes in a single test, which is a key measure to improve detection accuracy, as adopted by the gold standard RT-qPCR method. Developed here is a CRISPR/Cas9-mediated triple-line lateral flow assay (TL-LFA) combined with multiplex reverse transcription-recombinase polymerase amplification (RT-RPA) for rapid and simultaneous dual-gene detection of SARS-CoV-2 in a single strip test. This assay is characterized by the detection of envelope (E) and open reading frame 1ab (Orf1ab) genes from cell-cultured SARS-CoV-2 and SARS-CoV-2 viral RNA standards, showing a sensitivity of 100 RNA copies per reaction (25 μL). Furthermore, dual-gene analysis of 64 nasopharyngeal swab samples showed 100 % negative predictive agreement and 97.14 % positive predictive agreement. This platform will provide a more accurate and convenient pathway for diagnosis of COVID-19 or other infectious diseases in low-resource regions