| Target Pathogen | Pathogen Name | NCBI Taxonomy ID | Order | Family | Genus | Species | Pathogen type |
|---|---|---|---|---|---|---|---|
| SARS-CoV-2 | SARS-CoV-2, 2019-nCoV, COVID-19, COVID-19 virus, SARS2, Wuhan coronavirus, Human coronavirus 2019, COVID19, HCoV-19, SARS-2, SARS-CoV4 | 2697049 | Nidovirales | Coronaviridae | Betacoronavirus | Severe acute respiratory syndrome-related coronavirus | virus |
| Primer Name | Sequence(5'-3') | Length(bp) | Primer Final Concentration(μM） | GC Content（%） | Predicted Melting Temperature(℃） | Molecular Weight(g/moles) | Positions in GenBank accession number |
|---|---|---|---|---|---|---|---|
| RPA-Fow Primer (N-SARS-CoV-2) | TTCCTCATCACGTAGTCGCAACAGTTCAAGAAATT | 35 | \ | 40 | 62.02 | 10674.01 | \ |
| RPA-Rev Primer (N-SARS-CoV-2) | GTTCAATCTGTCAAGCAGCAGCAAAGCAAGAGCAG | 35 | \ | 48.6 | 65.95 | 10807.1 | \ |
| Application | Assay | Primer Designing Software | Reaction Time(min) | Assay Temperature(℃) | Readout System(s) | Limit of Detection(LoD) | Sensitivity(%) | Specificity(%) |
|---|---|---|---|---|---|---|---|---|
| \ | \ | \ | 20 | 37 | rkDNAeGO system | 1fm | 100 | 100 |
| Year of Publication | Title | Author(s) | Journal | PMID | DOI | ||
|---|---|---|---|---|---|---|---|
| 2021 | Combined recombinase polymerase amplification/rkDNA-graphene oxide probing system for detection of SARS-CoV-2. | Choi, Moon Hyeok; Lee, Jaehyeon; Seo, Young Jun; | ANAL CHIM ACTA | 33863409 | 10.1016/j.aca.2021.338390 | ||
Combined recombinase polymerase amplification/rkDNA-graphene oxide probing system for detection of SARS-CoV-2.Author(s):Choi, Moon Hyeok; Lee, Jaehyeon; Seo, Young Jun;Journal:ANAL CHIM ACTAYear:2021Abstract:The development of rapid, highly sensitive, and selective methods for the diagnosis of infection by severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) should help to prevent the spread of this pandemic virus. In this study, we combined recombinase polymerase amplification (RPA), as a means of isothermal DNA amplification, with an rkDNA-graphene oxide (GO) probe system to allow the rapid detection of SARS-CoV-2 with high sensitivity and selectivity. We used in situ enzymatic synthesis to prepare an rkDNA probe that was complementary to an RPA-amplified sequence of the target N-gene of SARS-CoV-2. The fluorescence of this rkDNA was perfectly quenched in the presence of GO. When the quenched rkDNA-GO system was added to the RPA-amplified sequence of the target SARS-CoV-2, the fluorescence recovered dramatically. The combined RPA/rkDNA-GO system exhibited extremely high selectivity (discrimination factor: 17.2) and sensitivity (LOD = 6.0 aM) for the detection of SARS-CoV-2. The total processing time was only 1.6 h. This combined RPA/rkDNA-GO system appears to be a very efficient and simple method for the point-of-care detection of SARS-CoV-2.PMID:33863409
|
|||||||