RPB0057

Pathogen Description

Target Pathogen Pathogen Name NCBI Taxonomy ID Order Family Genus Species Pathogen type
SARS-CoV-2 SARS-CoV-2, 2019-nCoV, COVID-19, COVID-19 virus, SARS2, Wuhan coronavirus, Human coronavirus 2019, COVID19, HCoV-19, SARS-2, SARS-CoV4 2697049 Nidovirales Coronaviridae Betacoronavirus Severe acute respiratory syndrome-related coronavirus virus

Primer Description

Primer Name Sequence(5'-3') Length(bp) Primer Final Concentration(μM) GC Content(%) Predicted Melting Temperature(℃) Molecular Weight(g/moles) Positions in GenBank accession number
COVID-19 RPA F3 GCAACAGTTCAAGAAATTCAACTCCAGGCAGC 32 \ 46.9 63.47 9795.45 28845-28876
COVID-19 RPA R2 TAGTGACAGTTTGGCCTTGTTGTTGTTGGCCT 32 \ 46.9 65.21 9874.43 28911-28842

Gene Description

Target Gene GenBank ID
N gene \

Assay Description

Application Assay Primer Designing Software Reaction Time(min) Assay Temperature(℃) Readout System(s) Limit of Detection(LoD) Sensitivity(%) Specificity(%)
\ \ \ 30 42 LF 1 copies/ul 97 100

Publication Description

Year of Publication Title Author(s) Journal PMID DOI
2019 A microfluidic-integrated lateral flow recombinase polymerase amplification (MI-IF-RPA) assay for rapid COVID-19 detection. Liu, Dan; Shen, Haicong; Zhang, Yuqian; Shen, Danyu; Zhu, Mingyang; Song, Yanling; Zhu, Zhi; Yang, Chaoyong; LAB CHIP 34008614 10.1039/d0lc01222j

A microfluidic-integrated lateral flow recombinase polymerase amplification (MI-IF-RPA) assay for rapid COVID-19 detection.

Author(s):

Liu, Dan; Shen, Haicong; Zhang, Yuqian; Shen, Danyu; Zhu, Mingyang; Song, Yanling; Zhu, Zhi; Yang, Chaoyong;

Journal:

LAB CHIP

Year:

2019

Abstract:

The COVID-19 pandemic, caused by SARS-CoV-2, currently poses an urgent global medical crisis for which there remains a lack of affordable point-of-care testing (POCT). In particular, resource-limited areas need simple and easily disseminated testing solutions to manage the outbreak. In this work, a microfluidic-integrated lateral flow recombinase polymerase amplification (MI-IF-RPA) assay was developed for rapid and sensitive detection of SARS-CoV-2, which integrates the reverse transcription recombinase polymerase amplification (RT-RPA) and a universal lateral flow (LF) dipstick detection system into a single microfluidic chip. The single-chamber RT-RPA reaction components are mixed with running buffer, and then delivered to the LF detection strips for biotin- and FAM-labelled amplified analyte sequences, which can provide easily interpreted positive or negative results. Testing requires only a simple nucleic acid extraction and loading, then incubation to obtain results, approximately 30 minutes in total. SARS-CoV-2 armored RNA particles were used to validate the MI-IF-RPA system, which showed a limit of detection of 1 copy per 渭L, or 30 copies per sample. Chip performance was further evaluated using clinically diagnosed cases of COVID-19 and revealed a sensitivity of 97% and specificity of 100%, highly comparable to current reverse transcription-polymerase chain reaction (RT-PCR)-based diagnostic assays. This MI-IF-RPA assay is portable and comprises affordable materials, enabling mass production and decreased risk of contamination. Without the need for specialized instrumentation and training, MI-IF-RPA assay can be used as a complement to RT-PCR for low-cost COVID-19 screening in resource-limited areas.