RPB0039

Pathogen Description

Target Pathogen Pathogen Name NCBI Taxonomy ID Order Family Genus Species Pathogen type
MERS-CoV Middle East respiratory syndrome-related coronavirus, MERS coronavirus, MERS virus, Middle East Respiratory Syndrome Coronavirus, Middle East respiratory syndrome coronavirus 1335626 Nidovirales Coronaviridae Betacoronavirus Nidovirales Virus

Primer Description

Primer Name Sequence(5'-3') Length(bp) Primer Final Concentration(μM） GC Content（%） Predicted Melting Temperature(℃） Molecular Weight(g/moles) Positions in GenBank accession number
COR12 RT-RPA FP AACTTCCACATTGAGGGGACTGGAGGCAA 29 \ 51.7 65.61 8975.9 28989-29291
COR12 RT-RPA RP AGAGTTTCCTGATCTTGAACCTTGTGAACT 30 \ 40 59.07 9187.03 28989-29291
COR12 RT-RPA P TCTTCAAGAGCCTCTAGCTTAAGCAGAAAC-BTF-TCCAGATCTAGTTC-P 44 \ 43.2 64.89  13434.79 28989-29291

Gene Description

Target Gene GenBank ID
NC gene JX869059

Assay Description

Application Assay Primer Designing Software Reaction Time(min) Assay Temperature(℃) Readout System(s) Limit of Detection(LoD) Sensitivity(%) Specificity(%)
\ \ \ 15 42 Exo Probe 10 copies 100 100

Publication Description

Year of Publication Title Author(s) Journal PMID DOI
2013 Reverse transcription recombinase polymerase amplification assay for the detection of middle East respiratory syndrome coronavirus. Abd El Wahed, Ahmed; Patel, Pranav; Heidenreich, Doris; Hufert, Frank T; Weidmann, Manfred; PLoS Curr. 24459611 10.1371/currents.outbreaks.62df1c7c75ffc96cd59034531e2e8364

Reverse transcription recombinase polymerase amplification assay for the detection of middle East respiratory syndrome coronavirus.

Author(s):

Abd El Wahed, Ahmed; Patel, Pranav; Heidenreich, Doris; Hufert, Frank T; Weidmann, Manfred;

Journal:

PLoS Curr.

Year:

2013

Abstract:

The emergence of Middle East Respiratory Syndrome Coronavirus (MERS-CoV) in the eastern Mediterranean and imported cases to Europe has alerted public health authorities. Currently, detection of MERS-CoV in patient samples is done by real-time RT-PCR. Samples collected from suspected cases are sent to highly-equipped centralized laboratories for screening. A rapid point-of-care test is needed to allow more widespread mobile detection of the virus directly from patient material. In this study, we describe the development of a reverse transcription isothermal Recombinase Polymerase Amplification (RT-RPA) assay for the identification of MERS-CoV. A partial nucleocapsid gene RNA molecular standard of MERS-coronavirus was used to determine the assay sensitivity. The isothermal (42°C) MERS-CoV RT-RPA was as sensitive as real-time RT-PCR (10 RNA molecules), rapid (3-7 minutes) and mobile (using tubescanner weighing 1kg). The MERS-CoV RT-RPA showed cross-detection neither of any of the RNAs of several coronaviruses and respiratory viruses affecting humans nor of the human genome. The developed isothermal real-time RT-RPA is ideal for rapid mobile molecular MERS-CoV monitoring in acute patients and may also facilitate the search for the animal reservoir of MERS-CoV.