RPB0031

Pathogen Description

Target Pathogen Pathogen Name NCBI Taxonomy ID Order Family Genus Species Pathogen type
SARS-CoV-2 SARS-CoV-2, 2019-nCoV, COVID-19, COVID-19 virus, SARS2, Wuhan coronavirus, Human coronavirus 2019, COVID19, HCoV-19, SARS-2, SARS-CoV4 2697049 Nidovirales Coronaviridae Betacoronavirus Severe acute respiratory syndrome-related coronavirus virus

Primer Description

Primer Name Sequence(5'-3') Length(bp) Primer Final Concentration(μM） GC Content（%） Predicted Melting Temperature(℃） Molecular Weight(g/moles) Positions in GenBank accession number
F GCCATTTGTCATGATGGAAAAGCACACTTTCCT 33 0.52 42.4 62.49 10087.62 \
R CTCATTGAGGCGGTCAATTTCTTTTTGAATGTT 33 0.52 36.4 59.08 10130.63 \

Gene Description

Target Gene GenBank ID
S NC_045512.2

Assay Description

Application Assay Primer Designing Software Reaction Time(min) Assay Temperature(℃) Readout System(s) Limit of Detection(LoD) Sensitivity(%) Specificity(%)
a promising tool for POC diagnostics of COVID-19 and other emerging diseases in resource-limited settings without diagnostic errors or bias. RPA-CRISPR-FAST NCBI-BLAST 20 37 fluorescence 6 × 10³ copies per μL \ \

Publication Description

Year of Publication Title Author(s) Journal PMID DOI
2022 Computer vision enabled funnel adapted sensing tube (FAST) for power-free and pipette-free nucleic acid detection Mengdi Bao,Shuhuan Zhang,Chad Ten Pas,Stephen J Dollery,Ruth V Bushnell,F N U Yuqing,Rui Liu,Guoyu Lu,Gregory J Tobin,Ke Du Lab On A Chip 36111877 10.1039/d2lc00586g

Computer vision enabled funnel adapted sensing tube (FAST) for power-free and pipette-free nucleic acid detection

Author(s):

Mengdi Bao,Shuhuan Zhang,Chad Ten Pas,Stephen J Dollery,Ruth V Bushnell,F N U Yuqing,Rui Liu,Guoyu Lu,Gregory J Tobin,Ke Du

Journal:

Lab On A Chip

Year:

2022

Abstract:

A simple, portable, and low-cost microfluidic system-funnel adapted sensing tube (FAST) is developed as an integrated, power-free, and pipette-free biosensor for viral nucleic acids. This FAST chip consists of four reaction chambers separated by carbon fiber rods, and the reagents in each chamber are transferred and mixed by manually removing the rods. Rather than using electrical heaters, only a hand warmer pouch is used for an isothermal recombinase polymerase amplification (RPA) and CRISPR-Cas12a reaction. The signal produced by the RPA-CRISPR reaction is observed by the naked eye using an inexpensive flashlight as a light source. The FAST chip is fabricated using water-soluble polyvinyl alcohol (PVA) as a sacrificial core, which is simple and environmentally friendly. Using a SARS-CoV-2 fragment as a target, a ∼10 fM (6 × 103 copies per μL) detection limit is achieved. To generalize standard optical readout for individuals without training, a linear kernel algorithm is created, showing an accuracy of ∼100% for identifying both positive and negative samples in FAST. This power-free, pipette-free, disposable, and simple device will be a promising tool for nucleic acid diagnostics in either clinics or low-resource settings.