RPB0020

Pathogen Description

Target Pathogen Pathogen Name NCBI Taxonomy ID Order Family Genus Species Pathogen type
SARS-CoV-2 SARS-CoV-2, 2019-nCoV, COVID-19, COVID-19 virus, SARS2, Wuhan coronavirus, Human coronavirus 2019, COVID19, HCoV-19, SARS-2, SARS-CoV4 2697049 Nidovirales Coronaviridae Betacoronavirus Severe acute respiratory syndrome-related coronavirus virus

Primer Description

Primer Name Sequence(5'-3') Length(bp) Primer Final Concentration(μM） GC Content（%） Predicted Melting Temperature(℃） Molecular Weight(g/moles) Positions in GenBank accession number
F TCTGATAATGGACCCCAAAATCAGCGAAAT 30 0.48 40 59.65 9192.07 \
R ACGCCTTGTCCTCGAGGGAATTTAAGGTCT 30 0.48 50 64.67 9213.03 \

Gene Description

Target Gene GenBank ID
N \

Assay Description

Application Assay Primer Designing Software Reaction Time(min) Assay Temperature(℃) Readout System(s) Limit of Detection(LoD) Sensitivity(%) Specificity(%)
simple, rapid (<30 ​min), and inexpensive test for SARS-CoV-2 RT-RPA-LF \ 20 39 LFA on paper strips and UStar cassettes/agarose gels 1 copies per reaction 88.1 93.9

Publication Description

Year of Publication Title Author(s) Journal PMID DOI
2023 Rapid isothermal point-of-care test for screening of SARS-CoV-2 (COVID-19) Jean-Marc Zingg, Yu-Ping Yang, Spencer Seely, Pratibha Joshi, Md Harun Or Roshid, Fabiola Iribarren Latasa, Gregory O'Connor, Jennifer Alfaro, Eduardo Riquelme, Sebastian Bernales, Emre Dikici, Sapna Deo, Sylvia Daunert Aspects of Molecular Medicine 37519861 10.1016/j.amolm.2023.100002

Rapid isothermal point-of-care test for screening of SARS-CoV-2 (COVID-19)

Author(s):

Jean-Marc Zingg, Yu-Ping Yang, Spencer Seely, Pratibha Joshi, Md Harun Or Roshid, Fabiola Iribarren Latasa, Gregory O'Connor, Jennifer Alfaro, Eduardo Riquelme, Sebastian Bernales, Emre Dikici, Sapna Deo, Sylvia Daunert

Journal:

Aspects of Molecular Medicine

Year:

2023

Abstract:

Rapid on-site diagnosis of emerging pathogens is key for early identification of infected individuals and for prevention of further spreading in a population. Currently available molecular diagnostic tests are instrument-based whereas rapid antibody and antigen tests are often not sufficiently sensitive for detection in pre-symptomatic subjects. There is a need for rapid point of care molecular screening tests that can be easily adapted to emerging pathogens and are selective, sensitive, reliable in different settings around the world. We have developed a simple, rapid (<30 ​min), and inexpensive test for SARS-CoV-2 that is based on combination of isothermal reverse transcription recombinase polymerase amplification (RT-RPA) using modified primers and visual detection with paper-based microfluidics. Our test (CoRapID) is specific for SARS-CoV-2 (alpha to omicron variants) and does not detect other coronaviruses and pathogens by in silico and in vitro analysis. A two-step test protocol was developed with stable lyophilized reagents that reduces handling by using portable and disposable components (droppers, microapplicators/swabs, paper-strips). After optimization of assay components and conditions, we have achieved a limit of detection (LoD) of 1 copy/reaction by adding a blocking primer to the lateral flow assay. Using a set of 138 clinical samples, a sensitivity of 88.1% (P ​< ​0.05, CI: 78.2-93.8%) and specificity of 93.9% (P ​< ​0.05, CI: 85.4-97.6%) was determined. The lack of need for instrumentation for our CoRapID makes it an ideal on-site primary screening tool for local hospitals, doctors' offices, senior homes, workplaces, and in remote settings around the world that often do not have access to clinical laboratories.