RPB0017

Pathogen Description

Target Pathogen Pathogen Name NCBI Taxonomy ID Order Family Genus Species Pathogen type
SARS-CoV-2 SARS-CoV-2, 2019-nCoV, COVID-19, COVID-19 virus, SARS2, Wuhan coronavirus, Human coronavirus 2019, COVID19, HCoV-19, SARS-2, SARS-CoV4 2697049 Nidovirales Coronaviridae Betacoronavirus Severe acute respiratory syndrome-related coronavirus virus

Primer Description

Primer Name Sequence(5'-3') Length(bp) Primer Final Concentration(μM) GC Content(%) Predicted Melting Temperature(℃) Molecular Weight(g/moles) Positions in GenBank accession number
F ACTACCGAAGAGCTACCAGACGAAT 25 0.4 48 59.21 7653.07 \
R GCCTTTACCAGACATTTTGCTCTCA 25 0.4 44 57.34 7542.97 \
P GGTGATGCTGCTCTTGCTTTGCTGCTGCTTGACAGATTGAACCA 44 0.2 50 70.87 13535.8 \

Gene Description

Target Gene GenBank ID
N MN985325.1

Assay Description

Application Assay Primer Designing Software Reaction Time(min) Assay Temperature(℃) Readout System(s) Limit of Detection(LoD) Sensitivity(%) Specificity(%)
rapid and simple detect SARS-CoV-2 RNA. auto-RPA–fluorescence PrimedRPA \ 42 real time fluorescence 5 copies/μL 100 100

Publication Description

Year of Publication Title Author(s) Journal PMID DOI
2023 A New Auto-RPA-Fluorescence Detection Platform for SARS-CoV-2 Jing Tian, Biao Chen, Bin Zhang, Tantan Li, Zhiqiang Liang, Yujin Guo, Huping Jiao, Fenghong Liang, Longquan Xiang, Fanzhong Lin, Ruiwen Ren, Qingbin Liu Laboratory Medicine 36200614 10.1093/labmed/lmac093

A New Auto-RPA-Fluorescence Detection Platform for SARS-CoV-2

Author(s):

Jing Tian, Biao Chen, Bin Zhang, Tantan Li, Zhiqiang Liang, Yujin Guo, Huping Jiao, Fenghong Liang, Longquan Xiang, Fanzhong Lin, Ruiwen Ren, Qingbin Liu

Journal:

Laboratory Medicine

Year:

2023

Abstract:

Objective: The outbreak of COVID-19 caused by SARS-CoV-2 has led to a serious worldwide pandemic. Quantitative reverse transcription-polymerase chain reaction (qRT-PCR)-based methods were recommended for routine detection of SARS-CoV-2 RNA. Because the reaction time and analytical sensitivity of qRT-PCR limits the diagnosis of SARS-CoV-2, development of a quick process of SARS-CoV-2 detection technology with high analytical sensitivity remains urgent. Methods: We combined isothermal amplification and fluorescence detection technology to develop a new auto-recombinase polymerase amplification (RPA)-fluorescence platform that could be used in the diagnosis of SARS-CoV-2. Results: By optimization of primers and probes, the RPA platform could detect SARS-CoV-2 nucleotides within 15 min. The limits of detection and specificity of the auto-RPA-fluorescence platform were 5 copies/µL and 100%, respectively. The accuracy of detection of the auto-RPA-fluorescence platform in the 16 positive samples was 100%. Conclusion: The RPA platform is a potential technology for the diagnosis of SARS-CoV-2 infection.