RPB0010

Pathogen Description

Target Pathogen Pathogen Name NCBI Taxonomy ID Order Family Genus Species Pathogen type
SARS-CoV-2 SARS-CoV-2, 2019-nCoV, COVID-19, COVID-19 virus, SARS2, Wuhan coronavirus, Human coronavirus 2019, COVID19, HCoV-19, SARS-2, SARS-CoV4 2697049 Nidovirales Coronaviridae Betacoronavirus Severe acute respiratory syndrome-related coronavirus virus

Primer Description

Primer Name Sequence(5'-3') Length(bp) Primer Final Concentration(μM) GC Content(%) Predicted Melting Temperature(℃) Molecular Weight(g/moles) Positions in GenBank accession number
F GCATTCAGTACGGTCGTAGTGGTGAGACACT 31 \ 51.6 64.74 9591.27 \
R TCTTACGAAGAAGAACCTTGCGGTAAGCCAC 31 \ 48.4 63.54 9513.25 \

Gene Description

Target Gene GenBank ID
ORF1a_S \

Assay Description

Application Assay Primer Designing Software Reaction Time(min) Assay Temperature(℃) Readout System(s) Limit of Detection(LoD) Sensitivity(%) Specificity(%)
rapid one-pot real-time amplification and detection of nucleic acids RPA-LUNAS \ 60 40 camera-based readout \ \ \

Publication Description

Year of Publication Title Author(s) Journal PMID DOI
2023 Glow-in-the-Dark Infectious Disease Diagnostics Using CRISPR-Cas9-Based Split Luciferase Complementation Harmen J van der Veer, Eva A van Aalen , Claire M S Michielsen, Eva T L Hanckmann, Jeroen Deckers, Marcel M G J van Borren, Jacky Flipse, Anne J M Loonen, Joost P H Schoeber, Maarten Merkx ACS Central Science 37122471 10.1021/acscentsci.2c01467

Glow-in-the-Dark Infectious Disease Diagnostics Using CRISPR-Cas9-Based Split Luciferase Complementation

Author(s):

Harmen J van der Veer, Eva A van Aalen , Claire M S Michielsen, Eva T L Hanckmann, Jeroen Deckers, Marcel M G J van Borren, Jacky Flipse, Anne J M Loonen, Joost P H Schoeber, Maarten Merkx

Journal:

ACS Central Science

Year:

2023

Abstract:

Nucleic acid detection methods based on CRISPR and isothermal amplification techniques show great potential for point-of-care diagnostic applications. However, most current methods rely on fluorescent or lateral flow assay readout, requiring external excitation or postamplification reaction transfer. Here, we developed a bioluminescent nucleic acid sensor (LUNAS) platform in which target dsDNA is sequence-specifically detected by a pair of dCas9-based probes mediating split NanoLuc luciferase complementation. LUNAS is easily integrated with recombinase polymerase amplification (RPA), providing attomolar sensitivity in a rapid one-pot assay. A calibrator luciferase is included for a robust ratiometric readout, enabling real-time monitoring of the RPA reaction using a simple digital camera. We designed an RT-RPA-LUNAS assay that allows SARS-CoV-2 RNA detection without the need for cumbersome RNA isolation and demonstrated its diagnostic performance for COVID-19 patient nasopharyngeal swab samples. Detection of SARS-CoV-2 from samples with viral RNA loads of ∼200 cp/μL was achieved within ∼20 min, showing that RPA-LUNAS is attractive for point-of-care infectious disease testing. Nucleic acid detection methods based on CRISPR and isothermal amplification techniques show great potential for point-of-care diagnostic applications. However, most current methods rely on fluorescent or lateral flow assay readout, requiring external excitation or postamplification reaction transfer. Here, we developed a bioluminescent nucleic acid sensor (LUNAS) platform in which target dsDNA is sequence-specifically detected by a pair of dCas9-based probes mediating split NanoLuc luciferase complementation. LUNAS is easily integrated with recombinase polymerase amplification (RPA), providing attomolar sensitivity in a rapid one-pot assay. A calibrator luciferase is included for a robust ratiometric readout, enabling real-time monitoring of the RPA reaction using a simple digital camera. We designed an RT-RPA-LUNAS assay that allows SARS-CoV-2 RNA detection without the need for cumbersome RNA isolation and demonstrated its diagnostic performance for COVID-19 patient nasopharyngeal swab samples. Detection of SARS-CoV-2 from samples with viral RNA loads of ∼200 cp/μL was achieved within ∼20 min, showing that RPA-LUNAS is attractive for point-of-care infectious disease testing.