RPB0003

Pathogen Description

Target Pathogen Pathogen Name NCBI Taxonomy ID Order Family Genus Species Pathogen type
SARS-CoV-2 SARS-CoV-2, 2019-nCoV, COVID-19, COVID-19 virus, SARS2, Wuhan coronavirus, Human coronavirus 2019, COVID19, HCoV-19, SARS-2, SARS-CoV4 2697049 Nidovirales Coronaviridae Betacoronavirus Severe acute respiratory syndrome-related coronavirus virus

Primer Description

Primer Name Sequence(5'-3') Length(bp) Primer Final Concentration(μM） GC Content（%） Predicted Melting Temperature(℃） Molecular Weight(g/moles) Positions in GenBank accession number
F GGGGAACTTCTCCTGCTAGAAT 22 0.12 50 56.29 6750.45 \
R AGACATTTTGCTCTCAAGCTG 21 0.12 42.9 52.81 6396.23 \

Gene Description

Target Gene GenBank ID
N \

Assay Description

Application Assay Primer Designing Software Reaction Time(min) Assay Temperature(℃) Readout System(s) Limit of Detection(LoD) Sensitivity(%) Specificity(%)
application in on-site environmental surveillance of SARS-CoV-2 virus. RT-RPA/CRISPR-Cas/G4-based colorimetric \ 20 39 observe the color change by the naked eye, or measure absorbance with a microplate reader. It can also be followed by taking pictures with a mobile phone, and the gray value can be calculated by Image J 0.84 copies/ µL \ \

Publication Description

Year of Publication Title Author(s) Journal PMID DOI
2023 RNA extraction-free workflow integrated with a single-tube CRISPR-Cas-based colorimetric assay for rapid SARS-CoV-2 detection in different environmental matrices Yuliang Kang, Jiali Wang, Wensi Zhang, Yuhang Xu, Bohui Xu, Guangbo Qu, Yanyan Yu, Bing Yan, Gaoxing Su Journal Of Hazardous Materials 37148798 10.1016/j.jhazmat.2023.131487

RNA extraction-free workflow integrated with a single-tube CRISPR-Cas-based colorimetric assay for rapid SARS-CoV-2 detection in different environmental matrices

Author(s):

Yuliang Kang, Jiali Wang, Wensi Zhang, Yuhang Xu, Bohui Xu, Guangbo Qu, Yanyan Yu, Bing Yan, Gaoxing Su

Journal:

Journal Of Hazardous Materials

Year:

2023

Abstract:

On-site environmental surveillance of viruses is increasingly important for infection prevention and pandemic control. Herein, we report a facile single-tube colorimetric assay for detecting severe acute respiratory syndrome coronavirus-2 (SARS-CoV-2) from environmental compartments. Using glycerol as the phase separation additive, reverse transcription recombinase polymerase amplification (RT-RPA), CRISPR-Cas system activation, G-quadruplex (G4) cleavage, and G4-based colorimetric reaction were performed in a single tube. To further simplify the test, viral RNA genomes used for the one-tube assay were obtained via acid/base treatment without further purification. The whole assay from sampling to visual readout was completed within 30 min at a constant temperature without the need for sophisticated instruments. Coupling the RT-RPA to CRISPR-Cas improved the reliability by avoiding false positive results. Non-labeled cost-effective G4-based colorimetric systems are highly sensitive to CRISPR-Cas cleavage events, and the proposed assay reached the limit of detection of 0.84 copies/µL. Moreover, environmental samples from contaminated surfaces and wastewater were analyzed using this facile colorimetric assay. Given its simplicity, sensitivity, specificity, and cost-effectiveness, our proposed colorimetric assay is highly promising for applications in on-site environmental surveillance of viruses.