RPB0001

Pathogen Description

Target Pathogen Pathogen Name NCBI Taxonomy ID Order Family Genus Species Pathogen type
SARS-CoV-2 SARS-CoV-2, 2019-nCoV, COVID-19, COVID-19 virus, SARS2, Wuhan coronavirus, Human coronavirus 2019, COVID19, HCoV-19, SARS-2, SARS-CoV4 2697049 Nidovirales Coronaviridae Betacoronavirus Severe acute respiratory syndrome-related coronavirus virus

Primer Description

Primer Name Sequence(5'-3') Length(bp) Primer Final Concentration(μM） GC Content（%） Predicted Melting Temperature(℃） Molecular Weight(g/moles) Positions in GenBank accession number
F TTCCAATTAACACCAATAGCAGTCCAGATG 30 0.2 40 58.34 9143.03 \
R ATATGATGCCGTCTTTGTTAGCACCATAGG 30 0.2 43.3 60.4 9212.04 \

Gene Description

Target Gene GenBank ID
N \

Assay Description

Application Assay Primer Designing Software Reaction Time(min) Assay Temperature(℃) Readout System(s) Limit of Detection(LoD) Sensitivity(%) Specificity(%)
rapid diagnosis of SARS-CoV-2 RT-RPA-CRISPR-Cas12a/Cas13a \ 30 42 CRISPR system 200 copies/mL \ \

Publication Description

Year of Publication Title Author(s) Journal PMID DOI
2023 CRISPR dual enzyme cleavage triggers DNA and RNA substrate cleavage for SARS-CoV-2 dual gene detection Tong Jiang, Runde Liu, Jilu Shen Journal Of Medical Virology 37695079 10.1002/jmv.29090

CRISPR dual enzyme cleavage triggers DNA and RNA substrate cleavage for SARS-CoV-2 dual gene detection

Author(s):

Tong Jiang, Runde Liu, Jilu Shen

Journal:

Journal Of Medical Virology

Year:

2023

Abstract:

The widespread dissemination of coronavirus 2019 imposes a significant burden on society. Therefore, rapid detection facilitates the reduction of transmission risk. In this study, we proposed a multiplex diagnostic platform for the rapid, ultrasensitive, visual, and simultaneous detection of the severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) open reading frame 1ab (ORF1ab) and N genes. A visual diagnostic method was developed using a clustered regularly interspaced short palindromic repeat (CRISPR)-Cas12a/Cas13a dual-enzyme digestion system integrated with multiplex reverse transcriptase-recombinase polymerase amplification (RT-RPA). Two CRISPR-Cas proteins (Cas12a and Cas13a) were introduced into the system to recognize and cleave the N gene and ORF1ab gene, respectively. We used fluorescent or CRISPR double digestion test strips to detect the digested products, with the N gene corresponding to the FAM channel in the PCR instrument or the T1 line on the test strip, and the ORF1ab gene corresponding to the ROX channel in the PCR instrument or the T2 line on the test strip. The analysis can be completed in less than 20 min. Meanwhile, we assessed the application of the platform and determined a sensitivity of up to 200 copies/mL. Additionally, dual gene validation in 105 clinical nasopharyngeal swab samples showed a 100% positive predictive value agreement and a 95.7% negative predictive value agreement between our method and quantitative reverse transcription-polymerase chain reaction. Overall, our method offered a novel insight into the rapid diagnosis of SARS-CoV-2.